Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1656
Length(NT) : 702
Best Gene Model Blast : Link to GSTUMT00003817001 E-value : 1e-111
Numbers of ESTs : 3

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE61404.1| Score: 205 E_value: 1e-14
KEGG Definition: Na+/K+ transporter
Accession: aor:AO090102000343 Score: 205 E_value: 5e-15
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG1341 Score: 201 E_value: 8e-17
PFAM Definition: No Hit Found
Swissprot: P28569|TRK1_SACBA

Sequence:
>Contig1656
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGCCACCTAACATCCTATC
CGTATTCTTCCTTAACGGCCACTCAATTCTTGTGTTATACCCTGGCTAGG
TCCGATCTTATTGTCCTAATGTCGATTTTCGCTACTGCTCAATAATATCC
TGTTCCTTCGTCGTCTGAAGGTGCTCACGTTTTCCCCCGTCCGTCTGACT
TGGGTCCTGCAGAAGCACTTGCCGCGCCCAAGTCATTTACATATCTTGAA
CCCTCCAACTTGCGTTCCGAGGAATCCGTTTGCATTGGAGATAGGGACAG
CTTCTGACCTGGGGAGGTTCCATCGATTTTGTTTTGAGGGGTCCAGACGA
AAGTGGGTGTTGAATAGTTAACTTTGCGGTTTCAACACTACTGCACCAAC
CCTCCGCGGCCCTGGCGCAGGATTCCGAGACCTTTACCCTTTTTGTTTAC
GAGTAACTAGGAACTTGTCACAGGAATAATTAACCAATAAGGTTTGCTAC
GATGGGATTACCGAGGAGATGGCAATTCAAGCCTCATTTCAACTTCATTA
CTGTACATTATGCATACGTCATTGGGATGGCCATCATCGGCTCGGTCATA
ATTTATCCTTACAAGAATATGCGGTACATTGACGCATTGTTCTTTGCTGC
TGGTGGAGCCACACAGTCTGGTCTGAATACAATTGATGCCAACCTTCTGA
AA

Sequences in the Contig:

SY0AAA57YN23FM1 SY0AAC40YD04FM1 SY0AAC48YL23FM1