Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1655
Length(NT) : 757
Best Gene Model Blast : Link to GSTUMT00011157001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: oligosaccharyl transferase stt3 subunit
Accession: ref|XP_001210144.1| Score: 930 E_value: 1e-98
KEGG Definition: hypothetical protein
Accession: yli:YALI0B16434g Score: 928 E_value: 9e-99
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2292 Score: 1071 E_value: 1e-117
PFAM Definition: STT3, Oligosaccharyl transferase STT3 subunit. This family consists of the oligosaccharyl transferase STT3 subunit and related proteins. The STT3 subunit is part of the oligosaccharyl transferase (OTase) complex of proteins and is required for its activity. OTase transfers a lipid-linked core-oligosaccharide to selected asparagine residues in the ER..
Pfam Number: pfam02516 Score: 683 E_value: 1e-72
Swissprot: O94335|STT3_SCHPO
Gene Ontology:
GO:0008250 = Cellular component: oligosaccharyl transferase complex
GO:0004579 = Molecular function: dolichyl-diphosphooligosaccharide-protein glycotransferase activity
GO:0006487 = Biological process: protein amino acid N-linked glycosylation

Sequence:
>Contig1655
TTGGCACGAATAACAAGCGACAAATCCTCCCCTTTCAACTCCACCACTTT
TCCTCAACCATGTCGTCCATTGAGGCACTCCTCAAGGACGAGTCTACAAG
AAATATCCGTAGACTGCTGAAGGCTGTTATTCTCCTTACTATTGCTGGTG
CTGCCGTTTCGAGTCGGTTGTTTTCTGTTATACGATTTGAAAGCATTATC
CACGAATTTGATCCATGGTTTAACTTCCGTGCCTCTAAATACCTCGTCAA
GAACGGGTTTTACAATTTCTGGGACTGGTTTGATGATCGAACATGGCATC
CGCTCGGTCGTGTTACTGGAGGAACTCTCTATCCAGGTCTCATGGTGACC
TCCGGTGCAATTTACCATATTCTCCGTATGCTCTCTATGCCAGTCGACAT
TCGGAATATCTGCGTTCTCCTCGCCCCGGCATTCTCTGGCCTCACGGCCC
TCGCAACATACCTCTTTACCAAGGAGATGAAGGATGAATCTGCAGGTTTA
CTCGCTGCGGCATTCATTGGTATTGCACCCGGTTATATTTCTCGTTCTGT
TGCGGGTTCATACGATAACGAGGCAATTGCTATCTTCCTGCTGATGTTCA
CCTTCTACCTCTGGATCAAAGCGTTGAAGGATGGGAGTGCCTTCTGGGGT
GCTCTGTGTGCCTTGTTTTACTTTTACATGGTTGCTGCCTGGGGTGGATA
TGTTTTCATTACGAACATGATACCTCTGCACGCATTTGTGCTGGTCTTGA
TGGGCAG

Sequences in the Contig:

SY0AAA57YN19FM1 SY0AAC25YE01FM1 SY0AAC30YP11FM1
SY0AAC5YO08FM1