Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1654
Length(NT) : 584
Best Gene Model Blast : Link to GSTUMT00012191001 E-value : 1e-41
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_05800
Accession: ref|XP_001241904.1| Score: 180 E_value: 6e-12
KEGG Definition: hypothetical protein
Accession: ang:An12g08760 Score: 175 E_value: 1e-11
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1664 Score: 168 E_value: 5e-13
PFAM Definition: vATP-synt_E, ATP synthase (E/31 kDa) subunit. This family includes the vacuolar ATP synthase E subunit, as well as the archaebacterial ATP synthase E subunit..
Pfam Number: pfam01991 Score: 108 E_value: 4e-06
Swissprot: Q01278|VATE_NEUCR

Sequence:
>Contig1654
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGCAAAATAGCTCTCAAAG
TCCAATATTCAAATGCACAAAAAGCTGCATTTTTAAATCACTCGTGATCG
AAACCCATTGGTTAGCCTTGAGCCTCCGTTTCTGTGCTTCCAAGTCCCCC
TTCCGGTTGTGCTCGTACATGTTCGTTTCTTGTCTTACCCTGCCAGAGCC
TCTTTCGCGTATCGTCGTCACACTAAGCTATCGCTCCGCATTTTTTCCAA
CCTCACCCCACCGCCGGCAACAACGGTTTTATCTTTTCTCGATACCAGAT
ACACTTCTATCCGTGATTTTCCTGCTTTCATCTACTTCGGTCTAATACCT
TTTACTTGTGGGTTCGTGATAGATAGAAAGCTCTATTGCTTTCCACACCT
TGAAGCAGCCAATCTTAAGTTTAATCAATCAAACAATAAACTACATTCAC
CATGGCGCACGCTCTCAGCGATGACCAGGTCAACAACGAACTAAAAAAGA
TGGTAGCCTTCATAAAACAGGAAGCCCTCGAGAAAGCCCGTGAGATCAGC
ATAAAAGCCGACGAGGAGTTCGCCATCGAAAAGT

Sequences in the Contig:

SY0AAA57YN14FM1 SY0AAB48YH11FM1