Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1653
Length(NT) : 1398
Best Gene Model Blast : Link to GSTUMT00012198001 E-value : 0.0
Numbers of ESTs : 15

Blast Results:

Nr Definition: hypothetical protein SS1G_05588
Accession: ref|XP_001594158.1| Score: 460 E_value: 9e-44
KEGG Definition: hypothetical protein
Accession: ncr:NCU07430.1 Score: 458 E_value: 7e-44
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0015 Score: 417 E_value: 2e-41
PFAM Definition: SRF-TF, SRF-type transcription factor (DNA-binding and dimerisation domain)..
Pfam Number: pfam00319 Score: 191 E_value: 3e-15
Swissprot: P11746|MCM1_YEAST
Gene Ontology:
GO:0000790 = Cellular component: nuclear chromatin
GO:0008301 = Molecular function: DNA bending activity
GO:0003688 = Molecular function: DNA replication origin binding
GO:0003700 = Molecular function: transcription factor activity
GO:0006270 = Biological process: DNA replication initiation
GO:0006357 = Biological process: regulation of transcription from RNA polymerase II promoter

Sequence:
>Contig1653
TTGGCTTCCCTCTGCCCTCCCCCTCCCATATCCAGATACAGGCAAACCAT
AACACAAGAAAAACACCAAACCCGAATCCAGTCAGAGGGACACATTTTTT
TAAAAAAAAAAAAAAATTTTCGCGGCTATGTCTGACAACGACCCACAACC
CTCCCCCGGTCCCCACGACGACTCCGCTGGCCCGAACGCTTCCGGTCTCG
CTGGCAATGGCGGAGTTCCGAATTCCAACCCCAATGCTTCCGGAGTCGAT
CCTTCTCGGGGAGTAAAACGAACCCGACCGAATCAAGATGACGACGATGA
TGATGAAGACAACAAGCCCGGCCGTGAGCGCAGGAAGATTGAGATCAAGT
TTATCCAAGACAAATCCCGACGTCACATCACTTTCTCGAAACGAAAGGCG
GGTATTATGAAGAAGGCCTACGAACTTTCCGTATTGACTGGCACTCAAGT
TCTGTTGCTCGTTGTCTCCGAAACAGGTCTCGTTTATACCTTCACCACAC
CCAAACTTCAACCATTGGTCACCAAGGCAGAAGGAAAGAACCTCATCCAG
GCATGTTTGAACGCGCCCGAGCCGCACTCCAATGAGAATGGCGTTGCTGA
AGGCGACTCGACTGTTGATTCCCCCGAGGAGCCACAACATACCCAACTGC
CCACTCAGGTCTCTGGACGTCCGCCAGTAGGAATGCCCGTGGGCCCGGGG
GTTCCGCCAGGCCCGTATATGAACATGCCAGACGCCGCTACCCAAGCACA
AGCCCATGCGTATCAACAATATATGCAACAGCAACAAGCTGCAGCTCAAG
TCCAGGCACAGCGCGGGGGTTACCTTCCTCAACATCCGGCTCAGATGCAA
CCACATCCGGCTCAGACGTCCTGATTTATTTACGCCATTTATGGCCCGCT
GACGGGGCATCAGAGGCAATCACCCCAGTCACCAAAAAAGCCGACACCAC
TTTCGCCTCTTTTAAATGAAGTCTACTGCTTCTCTTTGCCAATTTCTTGC
GCTGTGGTTCATTCAGGCGGTGTTGTTTTGGTTTACTGCGTGGTATCATT
ATTAACTGAACCACGTTTTCTTGGCTAAGGGACGATAGCGGAGACGGCTG
CCCTCTTTGGTCAAGGTGCCCTTTACAACCATTTTTTTATTTCTCTTCCT
TTTACTGTACTTTTGCATGTTTTTTCCTGTTCCATGTTCTATGCACTTAC
CTATTAATTGTTGGGATTTGCTTCTCATACAACTTACTGAGTTCATCTCA
CCCAGTGGTGTGGATTCGGAAAATTCCTTTGGGTTATGCTATGCTCCTTA
TGAAATGGAATCTGCTGTGTCTGTATGTTTGAGACACGTCTTCTGATTGC
CGACCTCTCTACCGAAATAGCGCCTTCTCGTCCCATTAATGTATTCTC

Sequences in the Contig:

SY0AAA10YP13FM1 SY0AAA46YK09FM1 SY0AAA46YN14FM1
SY0AAA48YF19FM1 SY0AAA57YA19FM1 SY0AAA57YN13FM1
SY0AAB18YP20FM1 SY0AAB20YM11FM1 SY0AAB21YD14FM1
SY0AAB30YO11FM1 SY0AAB33YM16FM1 SY0AAB58YI11FM1
SY0AAC56YI04FM1 SY0AAD45YJ13FM1 SY0AAD60YO24FM1