Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1652
Length(NT) : 700
Best Gene Model Blast : Link to GSTUMT00005090001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_05796
Accession: ref|XP_001592874.1| Score: 238 E_value: 2e-18
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01327 Score: 221 E_value: 7e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1652
TTGGGTTTGATCTTATCCCCCAATATATATACCGCTGGATTTCCACTGTG
TTTAGCCCCACCAGCCCTCTTACCGGCTTTATCGATACGTTCCACCGCCG
CCACCACCACTACCATTATCACAATAATAACTCGGCAACACAAAATACAA
GGGCTCGTGGGGGGCAGCCGCTAGCAATACAGACCATATGTCTGCACATA
GTCTCCACGCGTCTGTGCTTATCCTCCCTAATCCCCAATTATCGAGCCCG
GAACACCTTGCTTATGTACCCCGAGTGAAGAAAAACATTACTTTCGCTAT
CGATATCTCTGCCAACATCCGAACCCTTCACACGGGCGTCGCTTCGCAGG
GTGATGACATCTCCGGCTTGCTCTATGTGCCTATGGTAAATGAGACCACG
ACATGCCATGGCCTCTCTTCTGTCCCTACCAACGTTACACACAAGGATGA
CCTTCCGGATGCCATCTACGATTTGATTGCTTTTGCGCCTTGGATGTCGA
GAGACTGTAGTACTAGATTTTTGAAGGCCGCCCAGGTGGACGCAAGTGTT
GTTAAAGGATTTATATTTTATCTCGATGATAAAGCTGCGAAGATTCCCGA
GGTGAAGGATCCTTATTGGCATGGTGTTCCATTCGATAATTTCGAGTTCC
CAATCTATGCCATCCCTGGGAGAGATGGCATACCCCTGTTGGACAAGATT

Sequences in the Contig:

SY0AAA57YN06FM1 SY0AAD25YF23FM1