Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1651
Length(NT) : 732
Best Gene Model Blast : Link to GSTUMT00011763001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001217133.1| Score: 503 E_value: 3e-49
KEGG Definition: hypothetical protein
Accession: ang:An08g00750 Score: 502 E_value: 2e-49
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1730 Score: 398 E_value: 1e-39
PFAM Definition: DUF1000, Domain of Unknown Function (DUF1000)..
Pfam Number: pfam06201 Score: 366 E_value: 7e-36
Swissprot: Q6DJI5|CA128_XENLA

Sequence:
>Contig1651
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTCAAACCGTGCCTCTATT
CGAAGCTCTCCATTACCACAATTGACACACCATCTCCCCCCCACGATTCC
AAATAGCATACAATTTACGTTACTAAATTAACTGGACAAGGCTTTGTTAA
CAAGAGCAATGGCCGACCACTCACACTCCCACTGCCACGACGAACACTCC
CACGGCCACGGAGAGGGTGCGCATGACCACTCCGACGACGTCACACCCGC
CATTCAATCCTCTCTCTACAAGCACATAGACTTTGACAAGATAACCACTC
TGAACGAAGCTACTCCCGGCAGCGGACGAGATGTCGTTAGGAAATCCTGG
GAGGACCGGCTCGCCGGCACCCCCACCGTCGAAAGTGATGCAGACGAGGA
GCTCTTAATGTTCATCCCGTTTACCGGCCTCGTAAAGCTCCACTCAATCC
TCATCGGCGCGAACCCCGGAATCTCTGCCCCGAAAACCTTGAAGCTCTTT
TCAAATCGCGACGATATGGACTTTACTTCTGCTAGCGACACACAAGCCGT
ACAGACACTGGATCTCCCAGTGCCGCCTCCCGGAAATGACAGGGTTATGG
AGCTCCCAGTGAAGCGAGCGTTGTTCAACAATACTAGATCCCTGACTCTC
TTCTTTGAGAATAATCACTCGGATGGGGAGGAAGTTACGCAGATTACATA
TTTGGGGTTTAAGGGGGATTTGACTGAGTTGA

Sequences in the Contig:

SY0AAA57YM19FM1 SY0AAD45YI01FM1 SY0AAD56YK09FM1