Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1650
Length(NT) : 930
Best Gene Model Blast : Link to GSTUMT00006194001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_10217
Accession: ref|XP_001239195.1| Score: 274 E_value: 2e-22
KEGG Definition: hypothetical protein
Accession: ang:An15g01200 Score: 249 E_value: 7e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1650
TTGGCGATATTCTGAGAGCCAACAAAAACAACAAGTAATAATATAATATC
GTCCTTTCGCGATGCCTGCTATCATTACACGCCGTGACGACGGCCACCCG
CCGAGCACCCACGAGAATAACACCATGACCCATCTCCTCATTGTTCTAGT
CGTTTTAGTTTCCTTCGGTTTGGCCCTTGGAGGCTCACTCTTCTTCATCC
GCCGCATTCGCAGAGGCCGCAAAGTTGCTGGTGCCCTTCCCTCTTACGAA
GCATCGAACAAGAATCACCGTGGCCTTACAATCTCTACTCGTGACTCCGT
CCTTGTATGCTCCGAGAAACAACACCTGATCGATACCTCATCACCAATGC
CTCTTACACCCGAGAGTATTCCCGAAATCCGGATCACATTCCCGGAAGAA
GAGGATAAGCAAGGGCGTAGAGTCTCTGGCAGAGTCGTGGTTGTAGAGGT
TGGTGAGGCTGGAGTTGGATTTGTTCGTCCGTTGGAAAACGATGGTCTTC
CACCATATCAACAAAAATTGGAGGAAAGATTTGCATCAGTCGACCTGGAT
AGAATTGGTGGATTGAAAGAGAAGGAGACTGCTCCTTAAAGAACTCGACT
GTTGGAAAAAGGTGATGGCTGTGGTGGATTACCTTTTTCACGCGAGTCCC
TGGGGGTTTGTCCATTCTTTTTCATACGAACTTCTTTTTTTTCATCACTT
GTATCGACTCCTTTTTTTTTGGCGCAGGCGGAGAAACGAACGAACGGAGT
CCAGCAGTCACTCGTTATCCGGTCATGTGTTCTATTCGCCGAAACGATGT
GGATCTCATATCACGCTTTACTTTATGAGGGGGTTATCTTGGTCACGGTT
GGATTTCTTTCGATCTTTGGGAATGGGAGCTGGAGGAATATCCCCCCGGA
TAGAGAGAAGTGATGAGCTACTTTACTTTC

Sequences in the Contig:

SY0AAA27YK12FM1 SY0AAA57YM18FM1