Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig165
Length(NT) : 611
Best Gene Model Blast : Link to GSTUMT00010626001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: nuclear cap binding protein subunit 2
Accession: ref|XP_001557145.1| Score: 545 E_value: 3e-54
KEGG Definition: hypothetical protein
Accession: fgr:FG05488.1 Score: 533 E_value: 4e-53
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0121 Score: 573 E_value: 5e-60
PFAM Definition: RRM_1, RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain). The RRM motif is probably diagnostic of an RNA binding protein. RRMs are found in a variety of RNA binding proteins, including various hnRNP proteins, proteins implicated in regulation of alternative splicing, and protein components of snRNPs. The motif also appears in a few single stranded DNA binding proteins. The RRM structure consists of four strands and two helices arranged in an alpha/beta sandwich, with a third helix present during RNA binding in some cases The C-terminal beta strand (4th strand) and final helix are hard to align and have been omitted in the SEED alignment The LA proteins have a N terminus rrm which is included in the seed. There is a second region towards the C terminus that has some features of a rrm but does not appear to have the important structural core of a rrm. The LA proteins are one of the main autoantigens in Systemic lupus erythematosus (SLE), an autoimmune disease..
Pfam Number: pfam00076 Score: 163 E_value: 2e-12
Swissprot: Q9P383|YOJ1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0005819 = Cellular component: spindle

Sequence:
>Contig165
TTGGCACCCATCCACCACCACACCAAACACCATCCAACCTTTTCTCTTTC
TCCCCCTCCCCTCCTCCCTCCTCCCCCCAAAATGCCAATAACCACAGTCC
AACGCCTAGACGCCCCCTCCAGCTATTTCGAAAAGCGCGAACGCCGCCGC
AGCACCTCGCCAAAACCCGACCCCCTGAAGGACGCTTCGACCCTGTACGT
CGGCAACCTCTCCTTCTATACGACGGAGGAGCAGATCCACGAACTCTTCA
GCAAGTGCGGCGAGATCAAGCGATTGGTCATGGGCCTGGACCGCTTCACC
AAGACCCCTTGCGGCTTCTGCTTCGTCGAGTACTACACGCACAAGGACAC
GCTGGACGCCATGAAGTACATTGGCGGCACGAAGCTGGATGAGAGGATTA
TTCGCACGGATTTGGATCCTGGGTTCAAGGAGGGGAGGCAGTATGGTAGG
GGGCCCACCGGTGGGCAGGTCAGGGATTATTATAGGGACGATTACGATCC
TGGGAGGGGGGGGCCTGGGGGCAGGGAGCAGAGGCCTGTTGCCAAAGGGT
AGCATTTGCGCCCGGGCCGGAAAAATCGATTCCCTGTATCTGACTGACCC
TTTTTTCCCTT

Sequences in the Contig:

SY0AAA15YP22FM1 SY0AAB19YG17FM1 SY0AAB60YL10FM1
SY0AAC47YP01FM1