Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1649
Length(NT) : 650
Best Gene Model Blast : Link to GSTUMT00000898001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CIMG_03293
Accession: ref|XP_001243852.1| Score: 311 E_value: 5e-27
KEGG Definition: hypothetical protein
Accession: ang:An03g03460 Score: 306 E_value: 9e-27
KOG Definition:
Classification: [Defense mechanisms].
Kog Number: KOG4730 Score: 225 E_value: 1e-19
PFAM Definition: FAD_binding_4, FAD binding domain. This family consists of various enzymes that use FAD as a co-factor, most of the enzymes are similar to oxygen oxidoreductase. One of the enzymes Vanillyl-alcohol oxidase (VAO) has a solved structure, the alignment includes the FAD binding site, called the PP-loop, between residues 99-110. The FAD molecule is covalently bound in the known structure, however the residue that links to the FAD is not in the alignment. VAO catalyses the oxidation of a wide variety of substrates, ranging form aromatic amines to 4-alkylphenols. Other members of this family include D-lactate dehydrogenase, this enzyme catalyses the conversion of D-lactate to pyruvate using FAD as a co-factor; mitomycin radical oxidase, this enzyme oxidises the reduced form of mitomycins and is involved in mitomycin resistance. This family includes MurB an UDP-N-acetylenolpyruvoylglucosamine reductase enzyme EC:1.1.1.158. This enzyme is involved in the biosynthesis of peptidoglycan..
Pfam Number: pfam01565 Score: 171 E_value: 2e-13
Swissprot: Q7SGY1|ALO_NEUCR
Gene Ontology:
GO:0031966 = Cellular component: mitochondrial membrane

Sequence:
>Contig1649
TTGGTCGCCCGTAAATTATCCATCTTCCTCCTTACTGCCTCTTACTGTTC
GCTATAGTGTTTCGTAATTACATATTTTTATCTATCCTACCTTCCCGCTT
ACCTCGCCCGCTACTTCCTTCCTCACCACCTCACCACCCCTCCTCCCCAT
ATCGGCCTTATATCCAGCGTACTCTTCAGTCTTAGGGTCCATCGTAACTA
TTATTACCCCTCCGAGACTCACTTAACCCCGCCCCCCACAACCTCTTCCC
CTCCCGATATGGACCCTGAAGCACATAAGGGATTTCGGAAATATACCGGT
GATGCAATTTCAACACTTTCTTGGGACGCCGACACTGGTACGCATATTCC
ATTCAGAGCCTCGGTCAGTCACAAACACCGCACATGGGCAAAAACACATT
TTTCAAATCCGGAACTGTTCTTGCGGCCCCAGTCAGAGAAAGAGATTCGT
TTGATTGTTAATCTTGCTCGGCAATGCGGAAAGACGATCGTTGTGGTGGG
CTCGGGTCACTCGCCAAATGATCTCACCTGCACGTCATCCTGGATGGTGA
ATCTAGACGGGTTTAATTCGGTCGTCTTCGAAAATTGCCGTGAGCTACAG
CTCGAGGTCGAGGCTGGAATTAGGCTCCATCAGCTTGCGGACGAGTTAGA

Sequences in the Contig:

SY0AAA22YE10FM1 SY0AAA43YM18FM1 SY0AAA57YM15FM1