Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1648
Length(NT) : 670
Best Gene Model Blast : Link to GSTUMT00003932001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001544905.1| Score: 337 E_value: 5e-30
KEGG Definition: predicted protein
Accession: aor:AO090005001587 Score: 326 E_value: 5e-29
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3407 Score: 229 E_value: 5e-20
PFAM Definition: cwf18, cwf18 pre-mRNA splicing factor. The cwf18 family is involved in mRNA splicing. It has been isolated as a subcomplex of the splicosome in Schizosaccharomyces pombe..
Pfam Number: pfam08315 Score: 220 E_value: 5e-19
Swissprot: Q9UU80|CWF18_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005681 = Cellular component: spliceosome
GO:0000398 = Biological process: nuclear mRNA splicing, via spliceosome

Sequence:
>Contig1648
TTGGCACCTCGAAGCTATATCCAAGATTCAATACTATCATACACCCAACT
CTGAAAAGAAAAAAAGAAAAAAGAAAAACCTCCCTTACCACCTTGTTATA
ACTCAGAAACGAGAAAAAGAAGGGAAACAATTCAATCCTATCCTATTTCT
TACCATCGTCATGTCATCAATCGCTTCTCTCGACGCCCAGTCCGCAGCTC
GCAAAGAACGCCTCGCACAGCTCAAGTCTCTAAAGCGCAAACAGACCCTG
ACAGACCCTTTGCCACCACAAGAAGTCACAATGACAATGGATGATCCGGA
AGATCCGGAAAAGACTACGAATGCTCACCTCTCGGGCCGGAATTATGACA
TCGAGTCACGAGCACCCAAAATGGGGTTTGTGTCGGCACCCAACGTAGGA
CAGGAGACCTTGGAGGATGCAGCAAAGAAGATTGTCGAGACTACGAAGGC
TTTGCAAATGGAGGACGAAAGGAACGACAAGCCAATCGATTTGTTCAATC
TTCAACCAAAGAAACCGAATTGGGATTTGAAGAGGGATGTGGATAAAAAG
CTCGAGAAGTTGAACCAGAAGACAGATATTGCTATTGCGAAGATTATTCG
AGCTCGGATAGAGGAAGCACGACAGAAGAGAATTGGCAAGAGTAAGGGGG
GGGATGAGACGGAGGATGTT

Sequences in the Contig:

SY0AAA57YM14FM1 SY0AAB43YM19FM1 SY0AAC11YI08FM1