Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1647
Length(NT) : 914
Best Gene Model Blast : Link to GSTUMT00001276001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1647
TTGGAAGGAATTAGGGGTGGTTCTTGTTTGGCCGATACCCCGAAACCCCA
CCCTCGCGCTCGCGATGCGGGAAAGTTTGTTAGGGAAGTGGAAAGCGTCA
CCTGCAGCAATCCACGAGGGAGGGAGGATGCAACGCTTCGAAAGAAAAGG
GGGGGGAGGGGGGAACGAAAAAAGCTTGGTATCATACAATCTTCTGACCA
CGAACCTCAACCAATTCGCCGTGACCACACTGAGCAAAAGATTTTTTATG
AAAGATTTTCATCTTTCCGCCCACGAGTGGCCGAATTATGCCAGCAACGT
ACGTTCCGCTGGCTGGCAGCATCTCTGATGAAGAGTGGCAGCAATTCCTT
CAATGGAGAAGTGAGCGACAGCGGGAAACTCTACAGAATGATGTGGAGCC
TCATACACAAGACCAGGACGACACTACTGGTCTTCCTCCTCCCCCTCCCG
TTATAATCCTGGAAGGGCGTCAAATCGATGGACTCGGCCAGCAAGTTAAC
CCAAGAGACGAGGGGAAGGATGGAGGGGAACTACGGAAGAAAAGTAATAG
CCCATCACTAAAGAAGCGAAAGGGGAAAAAACGTTCATTCGGCCGCGAAT
ACAAACTTGAGGCTATCTCATATCTAGAGAACGGCACCATGCAGCTCACT
CCGATTTCATCTGAAACTCCCGTCTCTGTCCGCCACTGTGCCAAAATATA
CGGGGTTGAGCCCAAAAACATCCGCGACTGGCGACGGCAGGTGCAGAAAA
TCCGTGACAGCGAGACAGGCTCAAAGTGTATTGGAAGCGGGCGCAAGCCC
GATTGGCCGGAGATGGAAGACCGTCTACATCGTCTGTTTACCTTCCAGAG
GGAAAAGGACAAGAAAATAGAGGACAGCACGTGGTTCTTCACGAACGGGA
AGGACATATTTGAG

Sequences in the Contig:

SY0AAA57YM04FM1 SY0AAC55YG20FM3 SY0AAD20YK05FM1