Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1646
Length(NT) : 742
Best Gene Model Blast : Link to GSTUMT00003797001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein SS1G_11839
Accession: ref|XP_001586810.1| Score: 341 E_value: 2e-30
KEGG Definition: hypothetical protein
Accession: ncr:NCU06086.1 Score: 299 E_value: 7e-26
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG2536 Score: 161 E_value: 4e-12
PFAM Definition: No Hit Found

Sequence:
>Contig1646
TTGGTACCGTCTGAACCCCCATCAAAATAAATATAATGTTCTATGCCAGA
GCTGTCTCTCGCCTCTGGCGGGCCCCTTCCGCTAGAGTTTTCCTCTCGCT
TTCAATTTCTACCCCCAGGTCTCAATCCTCGGCTTTCCTCCGACCTGCTT
CGGTAGCACAGCATCCTCGTCTTGCCAGTCGGTTTTCTACCACTAATTCT
CGTTTCGAGAAATTGGGGCAAGTTGACGAGGAATTGGCGCTAAAACTCCT
GACCGAGATTGACCTTGAAAAATCAAAAGATGAGGCGGAGTACCCATTGA
GTGTAAAGGAATATTTGGAGACTGGCCAATTTGAGATTATCGATAAGCCA
GGCCAGGAGGAAGTCCAGCTTGTCCGCAGGTTCGGAGATGAGATTATCCG
TGTTGAATTCTCCATTTCGGATCTCAATGCTCTTGCGAACGAAGGATTGA
ATAATGATATTCTCTACGACGGACAGCCAGGAGAGGGTGACCACAACGCT
TTGTCTTCACAATCCGGGGGTGTACAATCCAAGGCTGCCCAAGGCGAAGG
AAGAGCCCTAGCAGCCAACGATACGGACAGCGACGAATACGACGATGATC
CCGAGCCAGGTTTCCCCGCTCGAGTAAATGTTACGATCGAGAAGCCAAAC
TCGGGCGCACTCCAAATTGAGGCCATTGCTCAGGATGGAATGATTGTCAT
TGACAATGTATTTTACCACAAGTCCGCAAAACTTGCCACGGC

Sequences in the Contig:

SY0AAA26YI07FM1 SY0AAA53YN19FM1 SY0AAA57YL24FM1
SY0AAA61YA22FM1 SY0AAB14YI04FM1 SY0AAB24YE05FM1
SY0AAB25YG20FM1 SY0AAB33YI21FM1