Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1645
Length(NT) : 707
Best Gene Model Blast : Link to GSTUMT00002607001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1645
TTGGAATCAACCTCGCTTATCTCTAAAAACTCACTTTTAAACACTCAGAG
TCAACGAGAGAAAACATCTATCACGAACCAAGACTCCACTACACGATGAG
GAAGCCTGATATTACAAGCCACTTTAGGGGCGGGATGGAAGAGCTCAAGA
CAGCGGACGGCATCACACTTTATGCCCATAAGAGTATACTTGACTTGGGA
ACCGAACCATGCCCGGACACCCCATGGGATAGTTTCACGACTTCTACGGT
GGAACGGTTCCTGGAGCATTGCTATCAGGGTGATTATAGCCCTCCGAAAC
CAGTTAAACTGCCATTGGCTACGCCCACAAGCAGTGTTGTCGACGGCGAC
GGGCACGCCGACGGGGTATTCCACACCGCAGCTGGCCGTCTTCCTCACTG
TCAGTCGGCAAACGGACTGGTCGTAGCTCAGCACGGCCAACACTTTTGCT
GCTCCTGTGTCGCCATCCAAGACGACGACACCGAAGAAGATGAGGCCAAC
AAAGACGATGACGCCGAGGGCAGCGACACCGAATACGGCGATGACGACAA
AGACGACTCTGGGTCATTAGGACATCCGAACGGCTTGGATTATTCCGAGG
TATTCTTTGCCCATGCAGAGCTCTACATCCTCTCCCAAACCCAGGGACGA
AGCTTGCTCACAGCTCTATGTCTCGATCGCCTTCGCACAGCACTCGGCGA
GGCAGCT

Sequences in the Contig:

SY0AAA48YP20FM1 SY0AAA57YL23FM1 SY0AAB28YF11FM1
SY0AAB3YL06FM1 SY0AAB41YK10FM1