Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1644
Length(NT) : 593
Best Gene Model Blast : Link to GSTUMT00003409001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_14703
Accession: ref|XP_001804886.1| Score: 307 E_value: 1e-26
KEGG Definition: hypothetical protein
Accession: ang:An02g07830 Score: 282 E_value: 4e-24
KOG Definition:
Classification: [Chromatin structure and dynamics].
Kog Number: KOG1973 Score: 157 E_value: 8e-12
PFAM Definition: PHD, PHD-finger. PHD folds into an interleaved type of Zn-finger chelating 2 Zn ions in a similar manner to that of the RING and FYVE domains. Several PHD fingers have been identified as binding modules of methylated histone H3..
Pfam Number: pfam00628 Score: 147 E_value: 1e-10
Swissprot: O74508|SPP1_SCHPO
Gene Ontology:
GO:0000785 = Cellular component: chromatin
GO:0048188 = Cellular component: COMPASS complex
GO:0005829 = Cellular component: cytosol
GO:0006338 = Biological process: chromatin remodeling
GO:0051569 = Biological process: regulation of histone H3-K4 methylation

Sequence:
>Contig1644
TTGGCACACCCGCAGCAGGGACTCCAATTGCGACCACGACGACCATGCCA
CCGAAATCTAAGAAGAACAAAGTGGCTAAAGCGCCCGCTCCCAGAAAGAA
GGGCGTTGCGAAGCTACAGAAAAAAAAGAGAAAAGCAGTAACCGATGGAG
ACGATGATCTTGAAGACGAAACTACCCCAAAGAAGAGACAGATTGCGAAA
AAGGTCGGGAAAAAGAGGGAGAGCGAGGCTCCCTCTGGATATAATACGGA
GACGGATGACCAAGATCCAGTTACTCGGGCTACGTCTGTCAAGAGGGATA
CTACCCCTCCATGCCCTCCTTCTCCGTCTATTCCTCCTTCGCCTTTGGAG
AGATACAATTCTGCTGGCTTAGAGCTCTACTGCATCTGCCGTGAGCCTGA
TTCTGGAAAGTGGATGATTGCTTGCGACGGTGAATGTGACGACTGGTACC
ATGGTGAATGTGTGAAGGTTGCAGAACAGGATGGCGAGCTAATTGATAAA
TACTACTGCCCAAGGTGCACCCACAAAGGCTACGGCCGCACAACCTGGAA
GCGCAAATGCCGCCTAACAACCTGCCGCCGACCAGCAGACGTA

Sequences in the Contig:

SY0AAA57YL14FM1 SY0AAA62YC12FM1