Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1643
Length(NT) : 3665
Best Gene Model Blast : Link to GSTUMT00004366001 E-value : 0.0
Numbers of ESTs : 311

Blast Results:

Nr Definition: hypothetical protein SNOG_14027
Accession: ref|XP_001804226.1| Score: 846 E_value: 5e-88
KEGG Definition: hypothetical protein [EC:3.2.1.3]; K01178 glucoamylase
Accession: spo:SPBC14C8.05c Score: 761 E_value: 2e-78
KOG Definition: No Hit Found
PFAM Definition: Glyco_hydro_15, Glycosyl hydrolases family 15..
Pfam Number: pfam00723 Score: 707 E_value: 1e-74
Swissprot: O60087|AMYG_SCHPO
Gene Ontology:
GO:0009986 = Cellular component: cell surface
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0005794 = Cellular component: Golgi apparatus
GO:0005628 = Cellular component: prospore membrane

Sequence:
>Contig1643
ATTCTTGATGGTGCCTAGTATAGGCAGAGAGGCAGATAAACCAGTAAAAA
ACGAAACACCAACAACAATAACATTCACAATCATAAGTGTTCCAACTCAT
GGAGTAAAGAAGTAGAAGAAGGAGAAGGAGAAGAGAGAGAGAGAGAGAGA
ACACGGCATGAAAAAGCCATCGTGAAGAGATTATTTGCCACCAGAAAGAG
TGTTCCCGGGCCTAGCGCTGATAAACCTCTTGAAAGTAGCACCGAGAAAG
CCATCCGGAGGCTTCTGGTCATCGTACCCATCTGCCATACGTTTTGCCCG
GGCACTCTCGAGACTGGCGAACATTGGACTCCCACGGCCATCGTTACCGC
CACCGAAGCTCAATCTTTTCTTTCTCGGGACCTGTTCTTTAATCTCCCTG
CCGGCTGCGTTCTCAGCGCTCGATGGTACGGTGACCGTATCTTGCGTTTT
TGCCTGCCCGGGCGTGACAATAGACAAGCCCTCGTGGACGAACTTGAACC
CATCGGCTTGGGTGTTGTAGTCCGCGTTCGGGGGGTCCTTGTCGTTCTGC
GACATCGTTGATTTGCTACTCTGCACTTCTAGTATGTTCGCTTTGTTTTT
GGGCGCCCGTGCGTGAAGGGATACTTGAAAAGTAATATATATTCCAGTGT
CAGGGGTTCAAACGATAGTCCGGGGGGACAACTTTGTACAAAAAAGTTGG
GGGGACAACTTTGTACAAAAAAGTTGGCGCGAACCTTTGCTTCTCAGCAC
TAATTTGTGGAGATAAATTTGTGCCCAAACGAGATCACTGGAATGTTCGG
CCTTGGGCTCCTGGAATCGGCGTTTCCTCGTTCTATGGGCTTCGCGTGGG
GTCCAAGATTTCGGGGGGAAAAGATAAAAAAGTCGCTATTATGGCCTCTT
GCCTTCGAAATTTCAACGGAAAACTGGTGCGTCGAGACTCGAGACCCATC
TCGGGGTGGTTCTGAGAGTTGTCTCCGCGGACCGAGCCGAAGAACTGCCA
ACGCTGTTGTCGCAGCAGTCAGAATTGAAAGCTTTTGTTTTCATTCTTAG
GTAACTTACCGCGCGGTCTTCCAGAAGTTCGTTGCGGTACCTTACAGGTT
CCCTTTCAGGGTCCAGAGCACCTGCCTAATGCTTCAACTCCAAATGTCCA
CAACGCCGGCTAAGATATCCTCGGCGTTAGACGGCATGACCGCATCACGG
AAGATCAGGCGCTCCTCTAGAAAGGACCCTGAGCCGGATGTACTGCGTCA
CGAGGCCAACTTTTTTTTTCCTTGTATGGACCTGACTCGAAAGTCGGTCG
TGATAATCCCGCCACGTACTCGTGTAGGTGCATCATACGTAAGGGCCACC
GGCACAGGTTTCGGCCCTTGTGGACCATTGGAACCGACTTCTCCCCGCCC
ACTATGCACTCCCCCCGCGCTTTCCCCCGCTTTGCCCGGCGTACAAAGCT
TCTTAGCTGTCCACATAAGCTTGGGGGCGAAGAAAGCGTTGGGCCATTAC
CACGCCAACTCTATCAACCAGTAGAATAGTCTTCTCGAACTCCATCCTTT
TTTTTTCAGCTCCTCCTCCCTCTCCCCCCTCTTGAGGTCACGCGGGACCT
GGAACCACGCCACGAACTTTCTAGGGATCCTGATGGTCTTGCTGCAACGA
CTATAGCTCCCTCTGGTTTCCTGCTTCTGGGGTTTTAGTATAAGGCTCCT
GGAATCATCATAGTATCGTTCCCTTCTCCAGAGATACTTACGGTATTTCT
TCGCAACTGCAGAAATTCACTTGGGCTCCTTTCTTCACTTCAGCTCCCCT
CAGTTCACGATACTGCGTTCTGGAGAACCCCAATACGCAAATAGCCTTCT
TGCTTTCATAACGATGGTTCTCCTTGAATCCATTCTAATCCCTGTTGCTA
CCCTGGGTTATTGCTCCGGTTTCGCAGCTGCTTACGTCGTTTCCGGACAC
TCTACCGACGCTCGACAGTTCACCATTTCAAAGGGTGAACCCCTGCCCTA
CGTTCATGACTCCACAACGTGGTATGAGGCCTCAACACGGCCCGTGAAGA
ATCTTGAAGATTGGATCGATCTTGAAGAAGGTCTCGCTTTTAAGTATCTT
CTCGATAATATCGCCCCTGGTGGTACCAACACTAAAGGGTGTCGGGATGG
AACGGTCATTGCCTCTCCCTCTAAGGCTTTCCCTAATTATTTCTACCAGT
GGATTCGTGACGCTGCGATAACTGTTCAAGGCATCGTCAATGAATATAGA
AAATCGGAGGATTTGGCGTTGAGGGATATAGTTGACCGCTATGCGGATAT
GCAGGCTGAGATACAGGAGACATTTAACCCGAGTGGAAGCTTTGCTACTG
GTGGACTTGGCGAACCAAAATTCATGGTTGACGGCACCCCCTTTACCGGG
TCATGGGCGAGACCTCAGAGAGATGGACCTGCCCTTAGGGCTCTTACTCT
CATGAACTTTATTAGAGTAGTTAACCAAACAAATCCGGAGCTCGTCACCT
TACAGTGGATCAACAAACTCTACAATCCCGATCTTGCAGCAAACTCTATT
GTAAAATCCGACTTGGAGTATGTATCTCATCACTGGGACGCCATCGGATT
CGACCTCTGGGAGGAAATTTTGGATTTACACTTCTTCACTGCTCTTGTTC
AGCATAAAGCATTAGTACAAGGCAGGGACCTTGCTCTGTCTCTCGATGAC
CACGGAGCTGCCTCATGGTATGATGGTCAGCAGGTGGCGTTGAAGCGCTT
CATCAAGGCCGAGTTCTGGGATGGACGTAATGGACACCTGAAAGCATACC
AACACACCCCCTATAGATCTGGACTAGACTGTGGCATAATGCTTGGCTCC
ATTCATGGTGGTCACAGTGACTTGTACCCCCCGTGGTCCGACGAGGTGCT
TGCTAGTACTCAAATGTTTATTAACCAAATGCAGAATTTGCATCCCATCA
ATAAGCGAAAGCCACCTTACTATCCTGAGGACGAGAGACTCCGGGGTGTT
GGTATTGGAAGATACGTCGAGGATATTTACGATGGTGTCCGCACCAGTGA
AGGCAATCCTTGGTTCCTTTGCACCTCGAGTGTATCTGACATTTTCTACA
CTGCCATCTCGCACTTTATCGACGAGGGTGAATTCCACATCACCCGCACC
AACCGCCCCTTCTTCGACAGGCTCCACCCTGCCGGAAGAGCCAAGCTTGG
GAGGGTCAGCTCGGGCGATTCCGACTTCCGCAACTACTTGCAAGCCATGT
TCACATATGCCGACAGTTTCCTCAACGTTATCCGCTACCACACGAAAGCA
GATGGCCGACTGAGCGAGCAATTCGACAAGTACGACGGATTCCAGAGGGG
AGCTCACGATCTTACCTGGAGTTATGGAAGCTTCTTGATGGCGGTTGATA
AGAGGCAGACAGCTAGGAGGGGGTTGTTTGGTTCGAAGTACTAGGAGTAC
CGTTTCCAGTGTATGCGTCATTAGGATGGGAACGCCGTCACCATTTTCAG
GATTGTGGAGTTTTGTTGTTTTCGGTCTTTATTCTCATCTGCGCAGAATT
ACCGTACTGCTTTTTTTCTGTTTTAAGGATTACCCCACATAGGTTTGCAT
TCGCTCTCATGAAAATGGCGCATCAAGGGTTTGGTTTTTTTTTCTTTTTT
CTTTTTCTTCTTGCC

Sequences in the Contig:

SY0AAA14YF10FM1 SY0AAA2YO05FM1 SY0AAA37YJ09FM1
SY0AAA57YK18FM1 SY0AAB14YK22FM1 SY0AAB22YA21FM1
SY0AAB33YO19FM1 SY0AAB34YB01FM1 SY0AAB34YO17FM1
SY0AAB39YD01FM1 SY0AAB44YE11FM1 SY0AAB55YC08FM1
SY0AAB55YJ08FM1 SY0AAB56YF06FM1 SY0AAC11YE01FM1
SY0AAC11YO21FM1 SY0AAC12YG07FM1 SY0AAC12YN16FM1
SY0AAC13YF06FM1 SY0AAC13YN07FM1 SY0AAC14YI22FM1
SY0AAC15YI04FM1 SY0AAC15YI14FM1 SY0AAC15YP07FM1
SY0AAC16YA15FM1 SY0AAC16YH20FM1 SY0AAC16YP08FM1
SY0AAC17YA15FM1 SY0AAC17YL21FM1 SY0AAC18YB20FM1
SY0AAC18YN20FM1 SY0AAC19YA15FM1 SY0AAC19YC13FM1
SY0AAC19YI06FM1 SY0AAC19YN12FM1 SY0AAC1YA05FM1
SY0AAC1YK21FM1 SY0AAC20YH11FM1 SY0AAC21YO05FM1
SY0AAC22YG07FM1 SY0AAC22YN06FM1 SY0AAC23YG05FM1
SY0AAC23YI06FM1 SY0AAC23YM04FM1 SY0AAC24YF21FM1
SY0AAC24YK17FM1 SY0AAC24YO17FM1 SY0AAC26YD22FM1
SY0AAC26YE05FM1 SY0AAC27YC04FM1 SY0AAC27YJ08FM1
SY0AAC28YF18FM1 SY0AAC28YH19FM1 SY0AAC28YJ12FM1
SY0AAC29YD23FM1 SY0AAC29YL19FM1 SY0AAC2YM18FM1
SY0AAC2YP22FM1 SY0AAC30YA21FM1 SY0AAC30YH17FM1
SY0AAC30YH18FM1 SY0AAC30YJ03FM1 SY0AAC31YF23FM1
SY0AAC31YG22FM1 SY0AAC31YH18FM1 SY0AAC31YK13FM1
SY0AAC31YP21FM1 SY0AAC32YI21FM1 SY0AAC34YH22FM1
SY0AAC35YM14FM1 SY0AAC36YE06FM1 SY0AAC36YH21FM1
SY0AAC37YE21FM1 SY0AAC37YH10FM1 SY0AAC37YK11FM1
SY0AAC37YK18FM1 SY0AAC38YA15FM1 SY0AAC38YE16FM1
SY0AAC38YG09FM1 SY0AAC38YH06FM1 SY0AAC38YJ22FM1
SY0AAC39YC14FM1 SY0AAC39YF14FM1 SY0AAC39YJ12FM1
SY0AAC39YK02FM1 SY0AAC39YK16FM1 SY0AAC39YN04FM1
SY0AAC39YO17FM1 SY0AAC39YP15FM1 SY0AAC3YF16FM1
SY0AAC3YG16FM1 SY0AAC40YJ08FM1 SY0AAC40YM18FM1
SY0AAC41YA04FM1 SY0AAC41YJ08FM1 SY0AAC42YB07FM1
SY0AAC42YL09FM1 SY0AAC42YP07FM1 SY0AAC43YF24FM1
SY0AAC43YP05FM1 SY0AAC44YB17FM1 SY0AAC44YJ13FM1
SY0AAC44YL14FM1 SY0AAC44YM13FM1 SY0AAC44YP19FM1
SY0AAC45YG10FM1 SY0AAC45YG13FM1 SY0AAC45YG21FM1
SY0AAC45YK11FM1 SY0AAC46YK23FM1 SY0AAC47YL07FM1
SY0AAC48YE02FM1 SY0AAC48YH11FM1 SY0AAC48YI15FM1
SY0AAC48YM08FM1 SY0AAC49YE06FM1 SY0AAC49YN07FM1
SY0AAC4YE24FM1 SY0AAC4YG21FM1 SY0AAC4YN04FM1
SY0AAC51YA22FM1 SY0AAC52YC17FM1 SY0AAC52YF07FM1
SY0AAC52YH09FM1 SY0AAC52YK13FM1 SY0AAC53YA05FM1
SY0AAC54YA07FM1 SY0AAC54YB20FM1 SY0AAC54YC04FM1
SY0AAC54YC09FM1 SY0AAC54YH19FM1 SY0AAC54YL05FM1
SY0AAC54YP02FM1 SY0AAC55YA10FM3 SY0AAC55YB07FM2
SY0AAC55YB21FM2 SY0AAC55YC16FM3 SY0AAC55YI11FM3
SY0AAC56YG13FM1 SY0AAC56YK13FM1 SY0AAC56YM04FM1
SY0AAC57YH24FM1 SY0AAC57YI24FM1 SY0AAC57YN23FM1
SY0AAC58YA21FM1 SY0AAC58YD08FM1 SY0AAC58YM15FM1
SY0AAC59YE14FM1 SY0AAC59YN07FM1 SY0AAC59YP07FM1
SY0AAC5YA16FM1 SY0AAC5YC07FM1 SY0AAC60YB22FM1
SY0AAC60YN05FM1 SY0AAC61YD01FM1 SY0AAC61YE21FM1
SY0AAC61YJ14FM1 SY0AAC61YK01FM1 SY0AAC61YK22FM1
SY0AAC62YC14FM1 SY0AAC62YD20FM1 SY0AAC62YG08FM1
SY0AAC62YI15FM1 SY0AAC62YK09FM1 SY0AAC62YM22FM1
SY0AAC62YP19FM1 SY0AAC6YG20FM1 SY0AAC6YH11FM1
SY0AAC6YI19FM1 SY0AAC6YJ05FM1 SY0AAC6YJ20FM1
SY0AAC6YP12FM1 SY0AAC7YB07FM1 SY0AAC7YN12FM1
SY0AAC7YO20FM1 SY0AAC9YM16FM1 SY0AAC9YN18FM1
SY0AAC9YP04FM1 SY0AAD10YC24FM1 SY0AAD10YD22FM1
SY0AAD11YF03FM1 SY0AAD11YG08FM1 SY0AAD11YP02FM1
SY0AAD12YE03FM1 SY0AAD12YK10FM1 SY0AAD12YL07FM1
SY0AAD12YP22FM1 SY0AAD13YF21FM1 SY0AAD14YD13FM1
SY0AAD16YF22FM1 SY0AAD16YG06FM1 SY0AAD16YI14FM1
SY0AAD16YN09FM1 SY0AAD17YJ20FM1 SY0AAD17YK09FM1
SY0AAD18YB10FM1 SY0AAD18YM23FM1 SY0AAD19YC11FM1
SY0AAD19YJ10FM1 SY0AAD19YN19FM1 SY0AAD20YI07FM1
SY0AAD21YE08FM1 SY0AAD21YI11FM1 SY0AAD21YJ11FM1
SY0AAD21YL03FM1 SY0AAD21YO24FM1 SY0AAD22YG14FM1
SY0AAD22YI07FM1 SY0AAD22YP14FM1 SY0AAD23YF08FM1
SY0AAD23YF21FM1 SY0AAD24YA09FM1 SY0AAD24YC12FM1
SY0AAD24YE23FM1 SY0AAD25YG05FM1 SY0AAD25YO11FM1
SY0AAD26YF05FM1 SY0AAD26YF16FM1 SY0AAD27YP20FM1
SY0AAD28YM03FM1 SY0AAD29YE19FM1 SY0AAD29YF15FM1
SY0AAD29YH08FM1 SY0AAD2YE04FM1 SY0AAD30YI05FM1
SY0AAD31YH23FM1 SY0AAD31YP17FM1 SY0AAD32YE13FM1
SY0AAD32YJ22FM1 SY0AAD33YB23FM1 SY0AAD34YB03FM1
SY0AAD34YB10FM1 SY0AAD35YH07FM1 SY0AAD38YH13FM1
SY0AAD38YJ12FM1 SY0AAD39YA06FM1 SY0AAD39YC01FM1
SY0AAD39YH07FM1 SY0AAD39YL20FM1 SY0AAD39YO20FM1
SY0AAD3YG07FM1 SY0AAD40YI22FM1 SY0AAD41YM24FM1
SY0AAD41YO21FM1 SY0AAD42YA06FM1 SY0AAD42YA13FM1
SY0AAD42YH02FM1 SY0AAD43YI21FM1 SY0AAD43YN12FM1
SY0AAD43YP13FM1 SY0AAD44YH12FM1 SY0AAD44YI21FM1
SY0AAD45YB14FM1 SY0AAD45YF16FM1 SY0AAD45YG22FM1
SY0AAD45YJ01FM1 SY0AAD46YL14FM1 SY0AAD46YN07FM1
SY0AAD47YG09FM1 SY0AAD48YD23FM1 SY0AAD49YI11FM1
SY0AAD49YK05FM1 SY0AAD49YO15FM1 SY0AAD4YN24FM1
SY0AAD4YO06FM1 SY0AAD50YA13FM1 SY0AAD50YE01FM1
SY0AAD50YG04FM1 SY0AAD50YG09FM1 SY0AAD51YD23FM1
SY0AAD51YJ10FM1 SY0AAD51YJ23FM1 SY0AAD52YA07FM1
SY0AAD52YA19FM1 SY0AAD52YM20FM1 SY0AAD55YB06FM1
SY0AAD55YB07FM1 SY0AAD55YI16FM1 SY0AAD55YJ04FM1
SY0AAD55YN19FM1 SY0AAD56YA04FM1 SY0AAD56YM16FM1
SY0AAD57YC01FM1 SY0AAD57YK18FM1 SY0AAD57YL10FM1
SY0AAD58YB18FM1 SY0AAD59YI16FM1 SY0AAD59YP13FM1
SY0AAD5YA12FM1 SY0AAD5YC22FM1 SY0AAD5YJ13FM1
SY0AAD60YB03FM1 SY0AAD60YG12FM1 SY0AAD60YM19FM1
SY0AAD60YM20FM1 SY0AAD60YP09FM1 SY0AAD61YG02FM1
SY0AAD61YJ08FM1 SY0AAD62YI13FM1 SY0AAD63YI14FM1
SY0AAD63YI15FM1 SY0AAD63YO16FM1 SY0AAD6YD07FM1
SY0AAD6YF03FM1 SY0AAD7YH14FM1 SY0AAD7YH23FM1
SY0AAD8YD15FM1 SY0AAD8YM09FM1 SY0AAD8YO01FM1
SY0AAD9YH04FM1 SY0AAD9YK22FM1