Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1642
Length(NT) : 815
Best Gene Model Blast : Link to GSTUMT00008896001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SNOG_10789
Accession: ref|XP_001801048.1| Score: 691 E_value: 6e-71
KEGG Definition: hypothetical protein
Accession: ncr:NCU01471.1 Score: 672 E_value: 5e-69
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1764 Score: 354 E_value: 2e-34
PFAM Definition: No Hit Found
Swissprot: Q9P869|SNF4_KLULA

Sequence:
>Contig1642
TTGGCCGTGCCCTCTCTCACCCCTAGTCCCTCCACAGACCCCCCCACCTT
TACTTCTTTTTTCCACTTTTGCGGAGGCTATCAAGAATCCATCAATGCTA
TCGACTCTATTTCCGATATCCGCCAAGTATCATGTCTGAGCCCGGTTCTT
CACTTCCTCCTCGACCTCCGAGCCCTGTGCGGCCCTCGTCGTACCTCCGC
CCACAGAGGCCACGGCCTCCACCAGAGCCTGTAGATGTCGTTGATAGAGA
GCAAGCCGAGGGACTGCGCGCTATTCGAGAATTCTTGAGGGTCCGAACTA
CCTATGACGTATTGCCGGTTAGCTTCCGTCTCGTGATACTGGATACAAGC
CTTCTGGTACAGAAGAGTCTCAATATCCTCATCCTTAATGGAATCGTCTC
CGCCCCGCTGTGGAACTCTCAGACGTCAACTTTTGCTGGATTGCTCACAT
CCTCTGACTATATCAATGTCATCCAGTACTACTGGCAATATCCCGAGAAG
TTTGAGGAAATCGAAGGGTTTCGCCTGGATAGTTTGCGAGAAGTTGAAAG
GGCTATCGGTGTTACACCTATAGAAACTGTTTCTGTGCATCCTATGATAC
AGTTGTATGATGCCTGCCGTCAAATGCTCCGAAGCCGCGCCCGTCGCATC
CCGCTCATTGATGTGGATGAGGAAACCCAACAGGAGATGGTAGTCAGCGT
CCTGACCCAGTTTCGAATTCTAAAATTCGTTGCCGTCAATGTACGCGAAA
CACAGATGTTGCGAAAGCCGCTATCTGACCTGAACATCGGGACATACGAG
GATATTTCTACAGCA

Sequences in the Contig:

SY0AAA24YF10FM2 SY0AAA50YD07FM1 SY0AAA57YK03FM1
SY0AAB26YH16FM1