Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1641
Length(NT) : 1249
Best Gene Model Blast : Link to GSTUMT00009856001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: hypothetical protein An16g07940
Accession: ref|XP_001398092.1| Score: 798 E_value: 5e-83
KEGG Definition: hypothetical protein
Accession: ang:An16g07940 Score: 798 E_value: 2e-83
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones, Signal transduction mechanisms].
Kog Number: KOG0686 Score: 632 E_value: 2e-66
PFAM Definition: PCI, PCI domain. This domain has also been called the PINT motif (Proteasome, Int-6, Nip-1 and TRIP-15)..
Pfam Number: pfam01399 Score: 119 E_value: 6e-07
Swissprot: Q5BD89|CSN1_EMENI

Sequence:
>Contig1641
TTGGGCCATCATCTCTATCCAGCAGGACCATTCTGAAAGAACGCACAGCC
TTACTTACATCCACCAAACATAGCAGATCGGATTAGGAACAACGGATAGG
AGTCGCTCATCTGGAAAACACCGTTTTAGGGAAGACTCACGCGATCGCAT
TAAATCATGGCAGGAAACTCGCTAGTAGATGCTTATTTCTCCCAGGCGAG
GAGTGAAGGGACTCTGGTTGTTGGTTTACCGAAGTTTGATTTGGACACTT
ACATCTCAGGCTATGCTGGGCGTACACGGATCGACCGACTCATCCATATT
TCTACCCACTCACCTCCTCTGGCGATCGAGGGACTGAAGTTGGCTATCAA
ATTGTTGAAGCAAACCCAGGATGTTCCCCGGTTCAAATTCGCTTTAGATA
TCCTCCGTAAACTCTCTCCAGAGGACGCAGATGCGGCTCAGGACGATGCT
TGGATTGAGAAGACTTCTAGGAAGGTTGTCGGTGATACAGAGAGAATCGA
GGCTGATCTGAAGAGCTACAAACATAATCTGATCAAGGAGAGTATTCGGA
TTGGCCACGAAGATCTTGGCAATCATCTATACGCATCTGGTGATCTCGTC
GGTGCCTTTAAGTGCTACTCTCGCATGCGCGACTTCTGCACCACACCGAA
ACACATTGTTGATATGTCCATACAAGCCATCAAGGTTTGCATCGAACAAG
GGCACTATTTAACAGTGCAATCGCACGTCCTCAAGATACGCAATTTAGCT
CGGGCGCCCGATGAAGAGGAACTTTTGAGGCCTAAGCTCTGTGTCGTTAC
GGGGCTTACACAACTAGCAAATGGTGACTTCAGAGCGGCGGCCAGGAGCT
TTCTGGATTGCCCACCAACCCTGCTCAACACTTACAATGAAGTCATCACC
GCGAATGATGTAGCAACCTACGGCGGACTTTGTGCTTTGGCCTCTATGGA
GAGAACGCAACTCAAGACTGAAGTTCTTGATAACGTTGAGTTCCGTAACT
TCCTCGAGTTGGAGCCACGTATGAGGAAGGCTATTTCTTTTTTCCATACC
GCAAAGAGTAAGGGAATAGTCCAATACTTCATACCATTTTCATGTGTGAC
TTTAGGCAGCATGGCTCAAGCTTTCGCCACGGATGAACGGACTTTGGAGA
AGGAACTTGTTATGATGATTGGCAAAGGAGCCTTGGACGCTAGAATCGAT
ACAAAGAATAGACTCCTTACTGCCAAAGAGACGAATCTTCGTGCAGCCG

Sequences in the Contig:

SY0AAA15YL11FM1 SY0AAA16YH20FM1 SY0AAA17YC02FM1
SY0AAA24YD08FM1 SY0AAA24YD08FM2 SY0AAA57YJ23FM1
SY0AAA57YL19FM1 SY0AAA60YF14FM1 SY0AAB19YG09FM1
SY0AAB37YD12FM1 SY0AAB51YC22FM1 SY0AAB52YP11FM1
SY0AAC38YJ18FM1