Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1640
Length(NT) : 2255
Best Gene Model Blast : Link to GSTUMT00005184001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: hypothetical protein BC1G_06540
Accession: ref|XP_001555017.1| Score: 918 E_value: 1e-96
KEGG Definition: hypothetical protein
Accession: mgr:MGG_06327 Score: 910 E_value: 5e-96
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1339 Score: 397 E_value: 8e-39
PFAM Definition: Asp, Eukaryotic aspartyl protease. Aspartyl (acid) proteases include pepsins, cathepsins, and renins. Two-domain structure, probably arising from ancestral duplication. This family does not include the retroviral nor retrotransposon proteases (pfam00077), which are much smaller and appear to be homologous to a single domain of the eukaryotic asp proteases..
Pfam Number: pfam00026 Score: 673 E_value: 7e-71
Swissprot: P22929|CARP_SACFI

Sequence:
>Contig1640
TTGGCAGCCTCGCTGGTAAGCGGATTCACGGACTGTTCCGACGTCACAAT
CACGGCTCGCTAGCCATCTTTCCTTTTTCCAACTTCGCCCTCCAGTTTTC
AGGTCTTCGGGTTCTGGACTCTCGAGTGACCCCCGAGGTCCTTTCCCCCT
TGTTTCTTGGCTTATATTGATTGATTGATTCCCCTTCTCCTCTCCCCATT
CCCCTCGAGCATACCACGGAACGTTGCTATTCTATTGCTTTGCCGTCGTT
ATTGCTTTTACCATTTTTACCCCACCAAGCACCTCTGTGGGGCCCTTCTC
TTGCATTCCACTATCCTGTTCTTCACATCCAATTCACAGCAGGTGGGGTA
ACTAAGTTGGCGCATGAAATGAAGTTTACGGGGTTGCTCTGTTCTTCTGC
CTTAGCATTTTGGGAGAATACCTTGGCTCTACACCTGCATCCGCCATCCG
AGAACGCAGGGAAAACCCTTTCGTTTGGATTCCAGAAAGTAAAGAGGAAT
GTCGATAATATTCCCCGGTTACGGAAGAGGGACTCTCCAAACACCGTCGG
CCAACGTTTGGACAATCTGGATTACCTTTACTATGCTAACATCAGTGTTG
GAACGCCGCCGCAAAAATTACGGTTACATCTCGACACGGGGTCCTCGGAT
GTATGGGTTGAAACGATGAACTCCTATATTTGCCAGCGACCTCAGAGGCC
ATGCCGGCGCACTGGGACGTTCAATCCGGATGGCTCGTCTACCTACGAGA
AGGTTAGCGACGATTTCGACATTTCTTATGTTGACGGAGAATATGCACGG
GGTGAATATGGAAAGGATGTGTTCACCCTCTCGGGTGGCGTGAAGGTGGC
TGGTTTGCAATTCGGCGTAGGCCTCGAGTCAACATCGACGGATGGGATTA
TGGGGATCGGTTTCAGCCTGAATGAGGTGCAGGTTCAGAGATTGGGGAAG
GATCCATATAGAAATTTGGTGGATCTTATGGTTGATCAGAAGCTCATCAG
GTCTCGGGCTTATAGTATGTGGTTGAATGACCTCGACGCTACCACTGGTG
AAGTATTATTTGGGGGAGTGGACACAGCCAAGTTCACAGGCTCTCTTACC
ACGCTGCCCATGGACAAACGTGTGGGAGAGGCTAAGGCCCGTGAATTTGC
TATTACCCTGACTTCCGTCTCAATTGCCAACTCTAGTGGAGGTTCCTTGA
CTCTGACGGCGAACGGTTACGCCAGCCCGGTAGTTCTGGATTCTGGATCT
ACTTATACTTACTTAGACCCTAATCTGGCTAAAGAGCTCGGCGATCAGGT
TGGCGCTCAGCCATTAGATCAGTATGGTGTAGCTGTTGTCCCTTGCGAGG
TCAGAGGTTATAATGGAAGCGTCACCTATGGATTTTCTGGGGCAACTATC
ACAGTTCCCCTGAGGGAGTTGGTTGTCGATGCTCGGGACAGGTCAGGAAA
GCCCGTAAGATTCAGTGACGGGACACCTCTTTGCTATTGGGGTATATTGA
GTTCTGGGGATCTGGGAACAAACGTTATGGGTGACACATTTCTCCGTTCC
GCTTATGTCGTTTTTGACCTCGACAACGAGGAAATAAGCCTTGCCAACAC
CCTCTATAACGTTACGGATAGCAGAATCCGTGAGATTGGCACCGGGAGGT
CGGCTGTTCCTGACGCGACTGGGGCTCCCAGTGCAGTCACGGTGCTAGCG
AGTGGCACTGGCATTAATCGTGGTAATGCGCGGCCCTATATTTCCGAGAC
TATGACTAGAAATTCTCCGCCCGACCCGACGGGCACCGCCAACCCTGCAC
CCTCACTTAATCCATCCTTTGCATCGACACTGTTATTATTCACCACTGTA
ACTATATCCCTTGTTTTATAGGCTCCGTTGGTACGAACAGAGTCACTTCT
AGAATGTAAATGTTTTATGACGGATGGCTACTTTTGGTTATATTGGAGTG
AGATGGATTGCTCTGCTCTATCTTGGGTTTATGGTGCTTTTGGCGGTATT
GTCTTTCTATTTATTCTCGTGTCCAACGCCTCTTGTGACACGATGATTTC
GGTTCGTTAAAAGGTTCCTATACAAGTATCATAGTGGAGTTGGGGGCAAA
TTGGGATTAATGGAGGTTGTTCTTTTTTTGAGTGCTGGGCGAACTGCCGG
TGCGGTATTGCGCAGGGTTTGGTCAATCCCGCCTAAGGGGTTTTGCTGCT
GCCGCCAAAGAAAGGTATATGCGAGTGAGAATATATGATGACAGGTTGAT
TTTGC

Sequences in the Contig:

SY0AAA16YA14FM1 SY0AAA17YD10FM1 SY0AAA1YO19FM1
SY0AAA22YD14RM1 SY0AAA25YG14FM1 SY0AAA28YG07FM1
SY0AAA37YK09FM1 SY0AAA38YN02FM1 SY0AAA44YK18FM1
SY0AAA57YB19FM1 SY0AAA57YJ17FM1 SY0AAB23YG14FM1
SY0AAB30YI12FM1 SY0AAB56YE02FM1 SY0AAB7YN20FM1
SY0AAD38YN05FM1