Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig164
Length(NT) : 1152
Best Gene Model Blast : Link to GSTUMT00004913001 E-value : 0.0
Numbers of ESTs : 17

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig164
TTGGCTTCCTTGAGAGTTCGCTCGTTGTTCGCCGTTTTTTTAGCGAACTC
ACCGGCGACGATCACCAGGAAATCTTTAAGACTACGGGAAAGGCAAAAGA
AGAGGGAACTATATCAGAACTTTCGCCATGGTTCAGGATGCTCGTTGGCC
TTCGAAGATACTAATCACCCTCAGGGGTGTGCAGTTGTTTCTCGCCATCA
TAGTGTTGGGACTGTCTGCATACATCGTCTCGGTGATTGATTACTGGTGG
GCATGTATGACTCTTGTCTCCGCACTTTTGACCCTCATTTATATCGGGAT
CAATTTCTTCCTTTTGTTCTCAAACTTGCTGCTTCCGCTAGCCATTACGA
TCACCGATGCCTTCCTAGCAGTGTTCTGGTTGATCTCCATGGCTGGAACC
GGGGATAGCGGGTACCTTTCTGTAAGCGACTGTGAGCTCACCGACTGGTA
CTGGCTTATTACCTACACAAGTACCGTCTGTCAAGTTTCCAAGGCCTCCT
TTGCCCTTTCATTCCTTCTTATGCTTCTATTCATTGGCTCTCTCGTTCTC
GCGGCCATAATCCTCGCCAAGAACCGAAAGGATCTCCGGGGGGCCAAATA
TAACTCGGGTATGGACCCAGATGGGAATCCTCTCCCAGACCATGCCGCTG
CCGCCCCCGCCGTTCCCGATGCCGTCGCGATGGACAGCGCCCCCAACCAA
ACCCAATACTACCAGGACCCTCCAAAGAACGAACACTACCAGCAGTCGCT
CACCCCGCAGCCGTACCAGAACACTACTTCGCCGGTGTACTACAACGCAA
CAGCAACACCTCAGCCGATCGCTTCTCCGTCGGCTACACCAGCTCCTTAT
TCACAGGTGGTTGGATACCCGCAAGCGGGAGTTGGCTCTCCGCCTCCGCC
GCCGCCAGTTAACGCTGCTGAGATGCCGACACGTTGATCACTTTCTGTAA
GGGGTGGTTCACGTTGAACTTTGACTGAATGATAATTTATGGGTTTAGTT
ATGAGGGTTTTCTCGAACTGGAAACATCTATGGAATTGCATTTTTTCTTT
CTTTTTTTTTCCCACCCGAATCTTTAACCTTTGGAGTGACTGGGCGTCGT
GTGTGTATATTATGATCGGTTTAATTAGGGGCTTTTTACCTATATTTGTT
GG

Sequences in the Contig:

SY0AAA15YP20FM1 SY0AAA24YC15FM1 SY0AAA24YE02FM1
SY0AAA3YK10FM1 SY0AAA45YM05FM1 SY0AAA48YM08FM1
SY0AAA50YP05FM1 SY0AAA52YP03FM1 SY0AAB30YN01FM1
SY0AAB33YJ05FM1 SY0AAB43YI21FM1 SY0AAC20YD07RM1
SY0AAC34YE13FM1 SY0AAC49YF09FM1 SY0AAC59YM22FM1
SY0AAC5YP10FM1 SY0AAC62YG18FM1