Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1639
Length(NT) : 820
Best Gene Model Blast : Link to GSTUMT00011237001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_13241
Accession: ref|XP_001585725.1| Score: 507 E_value: 1e-49
KEGG Definition: hypothetical protein
Accession: ang:An02g04050 Score: 497 E_value: 1e-48
KOG Definition:
Classification: [Signal transduction mechanisms, General function prediction only].
Kog Number: KOG2283 Score: 325 E_value: 5e-31
PFAM Definition: DSPc, Dual specificity phosphatase, catalytic domain. Ser/Thr and Tyr protein phosphatases. The enzyme's tertiary fold is highly similar to that of tyrosine-specific phosphatases, except for a "recognition" region..
Pfam Number: pfam00782 Score: 112 E_value: 2e-06
Swissprot: O08586|PTEN_MOUSE
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0051717 = Molecular function: inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity
GO:0030165 = Molecular function: PDZ domain binding
GO:0016314 = Molecular function: phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity
GO:0051800 = Molecular function: phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity
GO:0004438 = Molecular function: phosphatidylinositol-3-phosphatase activity
GO:0004722 = Molecular function: protein serine/threonine phosphatase activity
GO:0004725 = Molecular function: protein tyrosine phosphatase activity
GO:0001525 = Biological process: angiogenesis
GO:0048738 = Biological process: cardiac muscle development
GO:0007417 = Biological process: central nervous system development
GO:0043542 = Biological process: endothelial cell migration
GO:0006917 = Biological process: induction of apoptosis
GO:0046855 = Biological process: inositol phosphate dephosphorylation
GO:0043066 = Biological process: negative regulation of apoptosis
GO:0030336 = Biological process: negative regulation of cell migration
GO:0008285 = Biological process: negative regulation of cell proliferation
GO:0051895 = Biological process: negative regulation of focal adhesion formation
GO:0051898 = Biological process: negative regulation of protein kinase B signaling cascade
GO:0046856 = Biological process: phosphoinositide dephosphorylation
GO:0006470 = Biological process: protein amino acid dephosphorylation
GO:0031647 = Biological process: regulation of protein stability

Sequence:
>Contig1639
TTGGGATCACTTGTATCAGTTCCACCGCGCCATTTCTATATATCATATAA
AGCCATCTATACCGCCCCTATAACCCTCTGTCTTCACAGTGTTCTATTCC
AGATAACTTACTGGTATGATACCCCGTTCCACCAATACCATGCCCATGAG
TTACGGCCAGTCTTAGAATGAAATAGCACCGATCCAACATGACCTCAGAC
CCCATATCTTCTCAAAAAGCAACAAACTCTAGCCTTACCGCTTTCACGCT
CACCAATATCTTTTTACCAGCAGTGGCTGTGTACTTCAGCTATCCCTATA
TGACTTCTATCCTGCGATCCATCGTTGCCGGTCCCCGTCTCCGACATGGG
GAAGCTGGCCTAGACCTCTGCTATGTTAGCACATCGCCCACAATAATTGC
TATGTCTGTGCCAGCCGCAGAGTTCCCTAAAAAGGCATATCGGAACCCCC
TCGATCAAGTCGTCAAGTTCTTGGACAGCAAACACGGTCAAGGCTGGCGG
ATCTGGGAGTTCAGAGCCGAGGGAACGGGTTATAAAGATGAGGATGTATT
CGGAAGGATTTTTCATGCCCCGTTTCCGGATCATCACCCGCCCCCGTTTG
CTCTTGTGCCCGCTGTTTTGGCGAGTATGAGGAATCATTTGAAGGGAGAA
GGGAGGGAGAATGCTGTTGCCGTTATTCATTGCAAAGCCGGCAAGGGTCG
TAGCGGTACCATGTCATGTGCCTATCTTATCGGGGAAGAAGGTTGGTCCG
CGGATGACGCTCTGAAACATTACACAACAGTGCGAATGCGTCCTGGCTTC
GGTGAGGGCGTGAGTATCCC

Sequences in the Contig:

SY0AAA10YK03FM1 SY0AAA57YJ06FM1 SY0AAC19YP10FM1
SY0AAD36YM24FM1