Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1638
Length(NT) : 1104
Best Gene Model Blast : Link to GSTUMT00004617001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 310 E_value: 2e-26
KEGG Definition: hypothetical protein
Accession: mgr:MGG_05629 Score: 260 E_value: 5e-21
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 268 E_value: 3e-24
PFAM Definition: No Hit Found
Swissprot: Q02357|ANK1_MOUSE
Gene Ontology:
GO:0005515 = Molecular function: protein binding
GO:0048821 = Biological process: erythrocyte development
GO:0015672 = Biological process: monovalent inorganic cation transport

Sequence:
>Contig1638
TTGGGCACACTCCATCACAACCACTACTCGCCATGGCGCTCCTACTTGAC
CTCCCCAACGAGCTCCTCTTCCAAATAACCCATTACCTAACGCACAACGA
GATCTTCAACTTCCTCCGAGCGAACCGACGCCTAGCGAGGCTGCTCCAAA
CCGCACAATTCGACCGCCTCCGCCGTTTCCGCTCGCTGCCTCACGGACGA
AAAGCGCTCATCCACGCAGCGGCGCAGGAAGACATCGCTACGGTAGTGGA
ACTGGTGCGCATCGGCGCTCACAAGTTCACCATTGGCAAGGCGCAATTCC
TCAACTTCGCGATTCAAGACGGATGCAGTGCGGAGGCCATCAGCGTATTT
CTACGGTGCGGGATCGAGGCGGAGGGTACCGACATCCGGGGCCGCACCCC
GCTCGCCATCGCGGCGAGGGAGGGGCACGCAGATATCGTTAAGGTCCTGC
TGAAGGAGGAGGGGGTCAGCGTTAACGCGCAATGCCAGGAAGGCCGGACA
CCATTCATGTTCGCGGCCCTGGCCGGACATGCGGATGTCGTGCGGTTGCT
CCTAGATGACCTGAGGGTGAATGTTGGCTTGCGGGATGCGCCCCCGTTGG
CGAACCCCGCGGTTGCTCACTCCACGCTGCTCTTCCGCGTCGCGGCTGCC
GGCTTGTACGATGTTGCCAAGCTCCTCCTCGAGAGTACGAGGATCGACCA
TGAGACCGAGCTACTTGGGAGCAACTCCCGCACCGTCCTATGCAAAGCCG
TCGAGACGGGGCATCGGAAGGTGATAAAGCTCCTCCTGGACGATGGGCGC
TCGGATCCGAATTTCCTGAGCAGCGGCGAGACCCCGCTCCACTACGCTGT
CCGAGAAGGCCGCCTGGAGGCTGTGCGCTTGCTCCTCGCTGACCCGCGCA
TCGACGTCCGTAAAGTGTCCGCCCTGGGTATCACCCCGATACACCTGGCC
GCGAGGCAAAAACACAAGCCAATGATTCTGAAGACTCTGCTCCAAGATGG
GAGGGCTGATGTTAACGCTAGAAATCCCCGGGGGGAGACACCGTTGTTTA
CAGCGGTTATCGCGAATGCGCACGCTTGCGTTAAGCTCCTGCTAGAGGTG
GAGG

Sequences in the Contig:

SY0AAA57YI06FM1 SY0AAB42YL05FM1