Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1637
Length(NT) : 1021
Best Gene Model Blast : Link to GSTUMT00001410001 E-value : 1e-127
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SNOG_08957
Accession: ref|XP_001799261.1| Score: 223 E_value: 4e-23
KEGG Definition: hypothetical protein
Accession: yli:YALI0F01540g Score: 170 E_value: 1e-19
KOG Definition:
Classification: [Signal transduction mechanisms, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2605 Score: 113 E_value: 2e-06
PFAM Definition: OTU, OTU-like cysteine protease. This family is comprised of a group of predicted cysteine proteases, homologous to the Ovarian Tumour (OTU) gene in Drosophila. Members include proteins from eukaryotes, viruses and pathogenic bacterium. The conserved cysteine and histidine, and possibly the aspartate, represent the catalytic residues in this putative group of proteases..
Pfam Number: pfam02338 Score: 135 E_value: 6e-09
Swissprot: Q5T2D3|OTUD3_HUMAN

Sequence:
>Contig1637
AACAAAACGAAAAAAGAAAAGAAGAAAAAAAACACCCGCCAAGCCGCCTG
GGAAAACTCCTCTTCAAATCGGTTATTGCCAGTTGTGCCAAACAACCTAG
CAAAGATTTACAATACCTGTATGTATTAAATTTTTATCACACTCGTATAT
ACCGACTCTCACCTTCCGACCCCAAATCTCACTCAGCACCACCACAACCA
CCACCACAAAAAAGCAGAGGAAGCAAAACCCACCAACCCAGAAATGAGTT
ACTCCGATGAATTTCCACTACTCGAGGGGGCAGGACTCTACGCGTCCGAC
ATCTCCGGCGACGGGAATTGTCTTTTCCATGCGCTTAGTGATCAGTTATA
CGGGCATGAAAACAGTCACTCGGATATTCGGGAGAAGGTTGTTGAACATA
TGCGAAACAATGCCTCCTACTTCAAACTCTTCCTCAACGTAGGCCCAACC
CGGCGTGTACCCAAGCGGAAAGCAGCGAAGAATAATAACGCACTTGAACA
GGATGGCCAGATCTGGGGTTTACGGTGATAATATGGAGATCAGCGCGTTC
GCACGGGAGTATGGGTGCGACGTCAAGATTTACCAGAGGGATTTTGCTTA
CGTTGTTACTGGTGGGGAGGGAGGTGGTCATGAAGGAGGAGGGGGAAGAC
GAGATTCGGGGAAGGGGAAGAAAGTACTGCATATTGCCTACCATGTAAGT
TCTATATAACCCCCCCTGTCTGCCCTCCTATGCTCCAACTGCCCTACACA
CCACATCCGTATTAAACCTTTTTGGGACGGAGTCATAATAAAAAATGAGT
GATTGAATTGAAAAAAAAAACACACCCGGGAGAGATGAACAACAATTTTC
TAAGCTCATGCAAATCACGAATGCGGTTCAATCACAGACATGGGAGCACT
ACTCGTCAGTTCGGAACCGAGACGGACCGCACACCGGACTCCCGAACGTT
TCCCCGGTACCCTTAACCGAGGAAGGGCGTAAGGAGCATGAGAAGAAGTT
GGCGAATACCTCCTACGTGCG

Sequences in the Contig:

SY0AAA18YB21FM1 SY0AAA57YH23FM1 SY0AAB3YO11FM1
SY0AAC22YJ20FM1