Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1636
Length(NT) : 1908
Best Gene Model Blast : Link to GSTUMT00006280001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: hypothetical protein CIMG_02085
Accession: ref|XP_001248314.1| Score: 744 E_value: 2e-76
KEGG Definition: OTU-like cysteine protease, putative
Accession: afm:AFUA_3G05550 Score: 689 E_value: 2e-70
KOG Definition:
Classification: [Signal transduction mechanisms, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG3288 Score: 582 E_value: 2e-60
PFAM Definition: OTU, OTU-like cysteine protease. This family is comprised of a group of predicted cysteine proteases, homologous to the Ovarian Tumour (OTU) gene in Drosophila. Members include proteins from eukaryotes, viruses and pathogenic bacterium. The conserved cysteine and histidine, and possibly the aspartate, represent the catalytic residues in this putative group of proteases..
Pfam Number: pfam02338 Score: 159 E_value: 2e-11
Swissprot: O13974|OTU1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0043161 = Biological process: proteasomal ubiquitin-dependent protein catabolic process

Sequence:
>Contig1636
TTGGATTATATCAATGATTTCAACTGCAGGTACGGCAGAACAATCCCGGT
GCAGATCATGGGATATTCCGACCCGAACGGACAAGAGTTGAATTCGCGGG
GATGACATCAGAGCCTATCCATAATACAAACTGAAAAAGTCCCAAAGCTT
TGATTCATGCATTTTTTTTCTTCTCCCCGGCCTCTGGAGCAAGCGGCATC
CTTCATTGCCAACGTTTGTACTAGTACAGTACACCCTGCAGCAGAGCAAG
GTCACCAAGCATGATAAAGACTCGACATTTTTTATCCTCTACCCCATACC
TCCCCCTTTGGCGAAGTCTGCACCTGGGGCCGGAGAGGTAATGGTGGGGC
AAAAAGTGTTCGGGTGTCTGTGTGCATGAAACCTCGCTTTTAATCATCAC
AAAAGAGGACAGATCTCTGGGCAGGGGGGGCAGAAAGGCTTACGACTTCT
GAATATGTTCAGTTTGCTCGTGCACATTATACAGGAGGTCACAAGGGAAT
GTGGAAACAATTCGGCGATATTCTACCATCATCTTTCGCGCGTTGCTGCC
ACTTGCTTCCGGTATGAACCTGTTCTGCGATCAGGGAACACCCCACCCAT
TCATAGAAGTGAAAGGACCCCCCAACGCCAACACACACTTCACCACACCG
CACTCCGCACACTCAACCAACCAAAACAAAACCATCCAGACCAACCCCGT
GTAAAGGTAGTCCACAGCATTCCCCTTAAATTTCTGCGACGACAACGTTT
TTTACTCACAAACAGCAAAAATGCGAATCAAAATCCGCGCACCGAACGGT
TCCCAGGTCCTCGCATTATCACCAGAGACGACAATATCCTCCTTTCTCTC
AGAGATCCGCTCAAAGACATCTCTATCCGGCGACGTCGAGATCAAATATG
GCTACCCGCCTAAATCTCTGCATCTTAGCGAGTACCCATCGTCAACCCTT
CTCAGGGATATCCCCACCAAGCTCGAAGGCGAACAATTAATCATATCCGA
GAGTGGGGGAGGTGGTGGTGGTGGCGGCGGTGTAATTCGAGGGACCGGGT
CCATCGCCAACACTTCCACCGCTAGCAGAAGCGAGCCCCCTTCTGCCACT
GTTTACAGCGAGAAAGGGAAGTCTGTAGCAAAATCGAGCGCTCCGTTTTC
CTTCTCCGGAGGCGCACAAGATTCCACTTCGCAGCCCGACGCGCCCTTGA
CCTTAAATCGGTCCCTGAAACCCAAGATCAACAAAGACGATCCTCCCGAT
GTTCCCCTAAAGAGTGGACGTGGAACGATGGTTCTACGCGTGATGGAAGA
TGACAACAGTTGCCTTTTCTCGGCCATAAGTTACGTCGCCACGGGCTCCC
TTTACTCGGCCGCCGAGCTGCGCCAGCTTATCGCAACCACAATCCAGGAA
AACCCAGACATCTACAGCGAAGCAGTTTTGGAGCAAAAGCCAGACGGTTA
CTGTGAGTGGATCCAGATGGAGAGTTCTTGGGGCGGCGGAATCGAGCTAG
GAATTTTCGCAAATTTCTTCGATCTAGAGATATGCACCATCGATGTCTCT
ACAAACGAAGTCATCCGATTCAACGAGGGAAAAGCGAACAGAGCTGTCGT
GGTTTATTCCGGTATCCATTACGACACAATCGTCCTATCACCCGCCGGAT
CCCGAACAAATGATCCCTCCAAGGACAAGCGGATCTTCAGTTCCAGCGAT
GATGAGGAGCTAGAAGGGGCCTTGGAGCTTTGCAGAGAACTCAAGAAGAG
AAAGTATTTCACTGATACCAAAAGCTTTTCCCTCAAATGCAACATCTGCA
AAACCGGTCTCAAGGGTCAAAAGGCCGCTGTGGCGCATGCGAAAAGCACA
GGGCATATGGATTTCGGGGAGTACTAGAGCGGGGTGCGTTGGCTCTGTTT
TATTAGCT

Sequences in the Contig:

SY0AAA33YB18FM1 SY0AAA57YH12FM1 SY0AAA62YC22FM1
SY0AAB13YH20FM1 SY0AAC15YM24FM1 SY0AAC31YL19FM1
SY0AAC33YP05FM1 SY0AAC37YP12FM1 SY0AAC40YO04FM1
SY0AAC42YF01FM1 SY0AAC60YJ16FM1 SY0AAC8YE04FM1
SY0AAD6YN18FM1