Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1634
Length(NT) : 1847
Best Gene Model Blast : Link to GSTUMT00009646001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543415.1| Score: 1782 E_value: 0.0
KEGG Definition: mRNA splicing factor/probable chromatin binding snw family nuclear protein; K06063 SKI interacting protein
Accession: aor:AO090102000507 Score: 1764 E_value: 0.0
KOG Definition:
Classification: [RNA processing and modification, Chromatin structure and dynamics].
Kog Number: KOG2441 Score: 1340 E_value: 1e-148
PFAM Definition: SKIP_SNW, SKIP/SNW domain. This domain is found in chromatin proteins..
Pfam Number: pfam02731 Score: 641 E_value: 3e-67
Swissprot: Q4WEH7|PRP45_ASPFU

Sequence:
>Contig1634
TTGGCATCACGCTCCTTCGTCATGACATCTCTCGCCGCAGGTCTGTCAAA
AGCGCTCCCAGCTCCCAAATATTCCGCCGAGGAAGATGTTACAGCCAGCC
GGAAACCCACTGCACGAGTGCTCGGGGGGGGTGACCCTGACCAACAGGGC
TTAATTCTTAAGAGAACTGGTCCGCCCCCATACGGTCGGCGATCAGCATG
GCGACCTCGATCAGCAGACGACTTCGGGGATGGAGGTGCCTTTCCCGAGG
TTCCGATGGCACAATACCCGCTCGACATGGGTCGCAAAAGGTCGGGAACT
AGTAAAGCTCTTACTCTCCAGGTCGACAATGAAGGGAAAGTGAAGTACGA
TGCAATTGCCCGACAAGGCCATAATGATAAGCGAATAGTACACGCGTCAT
TCAAAGATCTTATCCCCCTCCGCCAGCGCGCAGACGTGGGCGAGATTTCA
TTAGAGAGGCCCTCGGAAGAGGATGTAGCGGCTACAACGGAGAAGACAAG
GCAGGCATTGGCAAGGTTAGTTTCGGGTGCCGTGGCCGCTCAGAAGCCGA
AGAATGTCAAGGGGACGAACAGAAAGGACGCTCAGTATGTCCGCTATACA
CCGTCAAATCAACTCGGTGACACGACCAAGCGCAGCGACAAGATCATCAA
GATTGTGGAACGACAGCAGGACCCTATGGAACCACCGAAATTCAAGCACA
AGAAGATCCCCCGAGGACCTCCGTCCCCACCTCCCCCTGTCATGCACTCA
CCTCCGCGGAAACTGACGGCAGCAGATCAGGAAGCATGGACTATTCCACC
CCCAGTCTCGAATTGGAAGAACCCTAAGGGATACACAGTCCCGCTTGATA
AACGTCTAGCAGCCGACGGCCGCGGACTCCAGGACGTTACCATTAACGAC
AAATTTGCACAGTTTGCCGAAGCGCTCTTCACCGCCGACCGGCATGCAAG
AGAAGAGATCAAACAGCGGGCATTAATGCAGCAAAAATTAGCCGAGAAGG
AGAAATCACAGAAAGAAGAGCACCTGCGAATGTTGGCACAGAAGGCCAGG
GAGGCCGCTCACACTGTTTCGCGGGGCCGCTCCCGCTCAAGATCGTCAGA
CGGCTCGCGAGACGACAGATCCCGCTCACGATCCCGTAGTTCGTCTGAGG
ATTCTAGGTCAGACGATGAGGCAGTGCGTGAGCGCGAGAAGATGCGTCGC
GAACGTCGGCAGGAAGAGGAACGTCAGCAGCGAATGAAGAACATGGGTTC
CGAGCGGAAAATGCAAATGTTAGCTAGGGAGCAGGGGCGCGATATTGGTG
AGAAGATAGCACTGGGTCTCGCGAAGCCGACACAGAGTCAAGAAACGATG
TGGGATTCAAGATTGTTCAATCAGTCATCTGCCTTTGGCGCGGGCTCCGG
CTTCAACGAGGATCAGCCGTACGATAAACCGCTCTTTGCAGCGCAGGAAG
CAGCGAACAGCATCTACAGGCCAAAAGTCAGTGTCGACGACGACGACGAG
GACACTGCCCGCAGCGAGATGGACAGAATAAAGAGGAATTCTCGATTTGA
AGTCCTTGGGAAAGCGCAACAGGGGTTCAGAGGTGCTGCTGACGCTGAGG
CCCGTGACGGCCCCGTCCAATTCGAAAAAGACGCCGCGGACCCATTTGGT
GTTGAAGCGTTTGTTAAAGCCGCAGGTGAGAAAGCCGGTACCAAACACGG
ACTACAAGAGCGAGATTCTTCGCCCGGAGGAAGTAAGCGGTCGAGAGCAA
ATTATATGTGATTTTTTTTCCTCTTATTTTCTTCCCCCCCACTCGACGCC
AACGGTGCCAATTTGGAAATTTGGTAGCGGAGACCACTCAATGATGG

Sequences in the Contig:

SY0AAA37YI03FM1 SY0AAA57YG17FM1 SY0AAB41YJ20FM1
SY0AAC45YD07FM1 SY0AAC53YP12FM1 SY0AAD20YF04FM1
SY0AAD31YE15FM1 SY0AAD41YK03FM1