Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1633
Length(NT) : 1033
Best Gene Model Blast : Link to GSTUMT00011630001 E-value : 0.0
Numbers of ESTs : 24

Blast Results:

Nr Definition: hypothetical protein CIMG_04638
Accession: ref|XP_001245197.1| Score: 243 E_value: 8e-19
KEGG Definition: hypothetical protein; K08508 synaptosomal-associated protein, 23kDa
Accession: ani:AN2419.2 Score: 214 E_value: 9e-16
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3065 Score: 134 E_value: 9e-09
PFAM Definition: No Hit Found
Swissprot: Q6C5G0|SEC9_YARLI

Sequence:
>Contig1633
TTGGCTAGCACCTTCGCCACGTCCACGTCCACCCCCTTCCCCCCTTAACT
TACCCTTTCCGCCACCCACCAAAGCCTCCTCCACCCCCGGGCACTGTCGT
ATTGGTCAAAGCGTTCACCGAATTTCTTCTCTTTCCCAGTCAGCTTAAAT
ATAGTTGCATTTCGGAGCCGGCCATTCATTGGAATACGCCAAGCCCTGCT
GTCAGCACGCCTCCTATCTCCTTCAGCTCACCGGCACTCAAATACTAACC
GTGTCCCCACGCCCCGAAGAATACAAATCCCTTCACCAACAGAACACACC
CAAAAACCAAACCAGTTCCGCACCCCCCACACAAAAACCCCACCCCACGA
AAATGAAAAAACTCTTTCGCGGATCCAAGGGAAGGACCCAACCGGAAGAC
GAAGATCAAAACCGTGATGCTCTCTTCGGCAGTCGGACAGCAGCAGCCCC
TCCTCCTCCCGGCGACGGATATGGGACCAATTCCAACCCCTACGCTCCTG
AACGCGGTGGGGGTAGAAATGGCTACGGAGCCCCTCAGGGTGGATACGGT
CGCAGTAATAATGAGATAGGAAACCGCGGGGGATATGGAGGTGCATCGAA
CCCCTACGCTCTTCACAATGGTGGAGATAACGGTGGACACAATTCGTCCG
GTGAGCCCGATCGTGCGCAGCTCTTCGGGGCAAGGCAGCAAAAGCACGAC
TACTCCTACACAGCGCACGCCAACGAACCTAGTGCTAGAGATGACGATGA
GGATACCGAGTTGGTGAAGCAGGAGATCAAGGATACGAATCGCAAGACTG
CTGGATTGACCGAGAGTGCCCTCGCCGCTGCCCGAAGGGCTGAAGCAAGC
GGCGTTGCTACTATTGAACGTCTTGGTATGCAGGGTGAACGTTTATCCAA
TACTGAAAAGAATCTCGACGTTGCGTCAGTTCAGAATCGTATTGCCGAGG
ATAAAGCCCGCGAGCTCAAGCAGTATAACAGATCTATGTTTGTCCCGGCT
ATGGGCAACCCACTTCGCTCCTCGGCTCGTGCC

Sequences in the Contig:

SY0AAA10YM23FM1 SY0AAA25YC07FM1 SY0AAA43YO10FM1
SY0AAA48YD05FM1 SY0AAA57YG09FM1 SY0AAA59YB08FM1
SY0AAA60YN12FM1 SY0AAB10YI14FM1 SY0AAB19YI19FM1
SY0AAB22YH16FM1 SY0AAB23YG17FM1 SY0AAB32YF08FM1
SY0AAB34YO12FM1 SY0AAB38YL13FM1 SY0AAB58YJ23FM1
SY0AAC22YD14FM1 SY0AAC25YC14FM1 SY0AAC49YL23FM1
SY0AAC58YC06FM1 SY0AAD30YG11FM1 SY0AAD34YG05FM1
SY0AAD45YN06FM1 SY0AAD51YM08FM1 SY0AAD62YC19FM1