Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1632
Length(NT) : 2098
Best Gene Model Blast : Link to GSTUMT00000202001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein BC1G_10535
Accession: ref|XP_001550976.1| Score: 1525 E_value: 1e-167
KEGG Definition: hypothetical protein
Accession: fgr:FG06885.1 Score: 1497 E_value: 1e-164
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1030 Score: 175 E_value: 4e-13
PFAM Definition: C2, C2 domain..
Pfam Number: pfam00168 Score: 209 E_value: 4e-17
Swissprot: O14065|YC31_SCHPO
Gene Ontology:
GO:0016020 = Cellular component: membrane
GO:0007165 = Biological process: signal transduction

Sequence:
>Contig1632
TTGGGGAAAATCCGACCCATATGTGCATGTCCTGCTATCGGGAGTTGAGA
AGGGCCGTACCGTCACTTTCATCAACGATCTAAACCCGGATTGGAACGAG
ATTCTATATATTCCGGTCCACTCTCCTCGAGAGAGATTGACGCTGGAGGT
TATGGACCAAGAGAATATGGGCAAGGATCGTTCGCTTGGTCATCTGGATG
TTAATTGTGACCAGTATATCAAGCAAGGCGAAGATGGCCTCTGGCTTGAA
CATAGTGAGAAGATTAATCGCAGTGAAGGCCTGAAGTTGGATCGTGGAGT
GAAGGGAACTCTTAACTTTACTGTTGCTTTCTACCCCTGCCTTAACATCG
CTGACCCGGAGGGAGAGGAGGCGGAGCGTAAACTCAAGGAGGGAGAAAAG
AACGAGAAATACGAGCAATCTGTCGAGCAAAAGGTAGAGAAGAGTGCGGT
TGATATTGAGAATGAGAAGTCCAAAGCGCAGATCGAGGAGAATACTCTTG
CCGAGGCGGCCGCAGGCTCTGACTCAGATGGCGATGAAAAGAAGACTTCT
AGGATCAAATTAACACCCAAAGAGTTGGTTAAATACGATTCTGGACTCTT
GGTTTTCAAGATTATTGAGGGTCAATTTGCACATAAAGGCTGCTACCTTG
AAGTCCTTATGGACGATATGTTGTATCCTGCATATTCCACTGCCAGAATC
AAGAGCAAGGATACAAAGTTTGGCGAAATTGGCGACGCTTTCGTTAGAGA
GCTCGAGTTCTCCAAGGTCACTCTGCGTCTGAGAGAGCATGGGAAGGATG
GAGAGCAAGAAGATGAAATTCTTGGAAAATTAACTGGTGGGACTCTGGAG
ACGGTGAAACAATGTTTGAACAACCCGACGGTCCTTGCTCTCAAAGACAA
GGACGGTGAGGTCAGCAAGGTCACGATCAGCTTGAACTATATTCCGGTTA
TGATGACTCTTGATCCCAGCGAGAGCATTAACAACATGGGTACCCTTAGG
GTGGACGTCTTGGATGCCGCGAATCTTCCCTCCGCAGACAGGAACGGCAA
GAGTGATCCTTTCTGTGTCTTTGCCTTGGACGGTAAATCATTATACAAGA
CTGATGTGCAGAAGAAGACATTGCATCCTTCTTGGAACGAATTTTTCGAG
ACTAAGGTTTCGTCAAGGACTGCCGCAAACCTCGTGGTTGAAATTTTTGA
CTGGGATTTGGCAGGCAAAGCTGATTTCTTGGCCAAGGGCCAAATCGATT
TGACGCAGCTTGAACCCTTCACACCGAAGCCTATTGTGATAAAACTCACT
GGTAAACAAGGCCAGGAGGGTAGATTTGGAGAGTTGAGGCTTAGGCTACT
GTTTAGATCAGGCTATGTCACCAGATCACGCCAAGGATCATCTACCTTCC
ATGGCACGTTCGCTACGCCTGGAAAGGTGGCTACTGGTGTTGCAGGAGCC
CCGCTCAAAGTTGGCGGTTTTGCTGCCGGCGGTATCACCAAGGGTGCTTC
CTTCCTGAAGAAGAGTGCATTTGGTCGCAAGGCCAAGGATACTAATGGCG
TTGCGGAGGAGATTGATCGGGAAATGCTAGCGCCCAGTTCAGCTGTCTCA
AACGGAGGTGCTACCAAAGGGATCAGTGAGGGCGGTGTCGCAGCTTATGA
TCCTGATGGAAGCCTGGTAGCTCTGGACGGATCAGAAGACAGCTTGGATC
CGGGGCAGAGAGCTTCCGGTAAGCGTACTGGCCTTAGTCATTCCCCATCC
ACGGCAGGAAGTCCTCATAACAGGAACAGAAGCGTCTCGAGCACGCTCTC
CGTACCCGGTGCAGCACCCGGAGGCGCTGATCACGGGACAGCGACTGTCA
GAATTGTTGCAGCTTCTGGATTCCCTACTAATTCTAACGTTCAACTCCGG
TTCAAGACCCTGGATAAAGGTAAAGAGCTTCATAAGAGCAAGTCTGTCAA
GTCTTCTACGGGTGAATTGGCTTGGGAAGAGAGTTTCTCTTTTAATTGCA
CAGCCGATCAACAGTTCAAGGTCTATGCAAAGGATAACCACCGCCTGCGT
GGTGACGAGGAATTGGGAGAGGGATTGTTTGTTGTCGATGATACCGGC

Sequences in the Contig:

SY0AAA34YF09FM1 SY0AAA57YF12FM1 SY0AAC12YD07FM1
SY0AAC12YK02FM1 SY0AAC41YA08FM1 SY0AAC42YN24FM1
SY0AAC62YL01FM1