Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1631
Length(NT) : 974
Best Gene Model Blast : Link to GSTUMT00004910001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001211849.1| Score: 234 E_value: 8e-18
KEGG Definition: hypothetical protein
Accession: ani:AN8917.2 Score: 204 E_value: 1e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1631
TTGGCTCAGGCGGGAAATCGGCCCGGTTTGTGTCCAGAGCTCTCCACATG
TGCGATACCCGTAAGTCCATTCCATCTTGGCTCCATAGCTTAAGAGTTCA
TGAACAATCCAATGTCCGAAGGCACCGACAAGCAAGAAACCGTCACCGGA
AGATGCCACTGCCAAGCAGTCACATACAGCTTTGCTTTTACCGGTCCATT
AGCAGCGTTTTACACTCATGAGGCCTTCATCAGACGTCAGACTGGATTCC
CTATTAATCTCTACATTCCTATGAACGCAGACTGCGACTTCCAGTTTCCA
TCTGACTCACCAAATCTACAATCCTTCAAATACGGCGATAAGACATCATT
CTTCTGTAAGACCTGCGGCACTACGCTTTTTTTCACTAAAAGAAGCTGGG
AACCGCCCTGCATATTGGCACCGACGATTGATGTGCTCTCTGGAAAACAA
TTAAGCGACTACGTCTATATCCAAGCACACATACATCTAAGCGAGGCGGG
AGGAGAAGTTGGTGGGATTGCGGACATTATTGAGGACGGGTTGCCGCATT
ATATGGAAGACGCGGGAAAATATCTCGACAGTGAGACGATAGCTATGGTA
GAGCGACCGGTGGTGGATGAGTCACAAGTGATGAGCGAGCATTGTCAGGG
GGTCCCGGACGTTCTGGACGGCCGCTGCTGTTGTGGGGCACTTCGCTTCT
CTATCGCAAGGCCTCCAGAGGACTATAGTAGTGATCCCACTCTGCTGCGC
TGGGTAAAACCAGGTGGGAAGTTTGCTGCTTCCTTTTGCTTCTGCACTTC
CTGCAGGACCGTTTCTGGAGCCCCACTCTTCGGTTGGTGTTTTACACCGA
CAAAACAGCTCCGCATATATCCACAGAGTACACCGAGGCTGTCAGTTTAC
AGATCCAGTGATAAAAGCACGCGCCGGTTTTGCGCTTCATGTGGCGCTAC
CGCGTTCTTTGCTTTAGACTCTTT

Sequences in the Contig:

SY0AAA50YE14FM1 SY0AAA57YF08FM1 SY0AAB49YG15FM1