Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1630
Length(NT) : 733
Best Gene Model Blast : Link to GSTUMT00006450001 E-value : 1e-128
Numbers of ESTs : 4

Blast Results:

Nr Definition: transcription factor Fst12
Accession: gb|AAM34282.1|AF509340_1 Score: 369 E_value: 1e-33
KEGG Definition: hypothetical protein
Accession: fgr:FG07310.1 Score: 369 E_value: 6e-34
KOG Definition: No Hit Found
PFAM Definition: STE, STE like transcription factor..
Pfam Number: pfam02200 Score: 127 E_value: 4e-08
Swissprot: O74252|STE12_EMENI
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0016564 = Molecular function: transcription repressor activity
GO:0000122 = Biological process: negative regulation of transcription from RNA polymerase II promoter
GO:0019953 = Biological process: sexual reproduction

Sequence:
>Contig1630
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCAAAAAAAAGCTTTCTGAAGTAATTCTCCCCCTACTTCACGG
GCTCTCTTTGTTTTTATATTTTTATTATTATTTACGTCTACGCGTCCAAG
GGACAGGTCTTTCTTTGCGCAGGACAACGGAGGCAGGACCCTCCCCTTCG
TTCCTTCGAGATCTTCATCACGCTCTCTAAAGCCGTGCTCCATTGCTTTT
TGCCTTTCGCTATTTTATTTTTCATTTTTTCAAAAAAAAAATCCTTCGTT
TTTTTAAGAAATCCTGCCTGGGCTAGATACTACGCGGCAGCCGCTCGAGA
CTTACTCCATCCTGAGCATTTACCCCTCTTTAGCCCTTCACCATCCTGCA
ACCACAACTGCAGCCCAGAATTCGCAACATATTCCGCCAAAAATTTATCA
CAGTGCCGGCCGCTCCAAGGCGTGACCGCAATAATCATGGCCCACCTAAT
GTATAGCCAGCATCACCTCGCGAATCAGAAGCCTGAAACTTTCATGCTCT
CGACTGAAGCCCAACAGTCATTACCTCAGGATGCTCAAGTAGCTCTTCAG
CAAGTTGATAACTTGAAATACTTTCTCATTTCTGCCCCAGTCGACTGGGC
GCCTGATCAATACATAAGGCGGTTTTTATTACCGACAGGCGAATACTTAT
CCTGTGTCTTATGGAATAACCTTTTCCATATCT

Sequences in the Contig:

SY0AAA12YC21FM1 SY0AAA57YF03FM1 SY0AAB47YO13FM1
SY0AAB55YE06FM1