Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig163
Length(NT) : 334
Best Gene Model Blast : Link to GSTUMT00011095001 E-value : 2e-85
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001553108.1| Score: 216 E_value: 2e-16
KEGG Definition: conserved hypothetical protein [EC:2.2.1.1]; K00615 transketolase
Accession: mgr:MGG_02471 Score: 216 E_value: 1e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q12630|TKT1_KLULA

Sequence:
>Contig163
TTGGACCGATTTGGCGCTTCCGGTCCTTATAAGCAGGTGTACGAGAAATT
TGAGTTCACACCTGCTGGAATCTCCAAGCGTGCCGTCGCTACAGTTGGCT
TTTGGAAGGAAGTTACGCCTATCAGAAGCCCTATCAACAGGGCTTTCACT
CAATTGATCTAAATACATGTCTAGGCCTAAATGGAGCTTAGACAGTCCTC
AGATAGATAACTGCTTTTGCGTTTTTCGCTTTTTCATATTGCCTTTTTTG
GGGGGATTTCGTGTTGGGTCTGCCTTGGGAAATTATCAATTAATTCTAGC
AACCCATTAAATTATACAAAGCAACTTGCACGTT

Sequences in the Contig:

SY0AAA15YP02FM1 SY0AAB39YN07FM1