Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1629
Length(NT) : 875
Best Gene Model Blast : Link to GSTUMT00001770001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein AN4524.2
Accession: ref|XP_662128.1| Score: 144 E_value: 2e-07
KEGG Definition: hypothetical protein
Accession: ani:AN4524.2 Score: 144 E_value: 9e-08
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 144 E_value: 5e-10
PFAM Definition: Extensin_2, Extensin-like region..
Pfam Number: pfam04554 Score: 136 E_value: 4e-09

Sequence:
>Contig1629
TTGGCTACCAATAATTATTAACCTACCACTCGCTGCTTGCTACTGTTCTA
TGACACCTTGCTCCACTCCCTCTCTCCCTCTCTCCTCCACCACCACCACC
ACCACCACCACCACGTTGCCACACACACACACAAGCACAATGAATTGTCC
TCCAGAATACCCCTTTCAAAGCTACTCCTACTTGACTCAACCCTTCTTCC
CAACCACGGCACAACTCCCCTGCCCACCGTACCCATCACCCCAGCATTCA
CCGCTCTCCCCACAGCTGGAGCAAAAGTACTTCCACCACCACCACCCAAC
CACCTTCGCACTGGACCCATTCCTCTCCTCTCCCCCTCCACCCCCTCCTC
CCGCTCCAGCGCTCCAGGAACCCATGTCCCCGACACTCCCCGCAATCAAG
CAGGAATCGGTCCCCGAACCGTCCCCGGAACCCACCACCGCTACAACTAC
CGCCGCCGCCGCCGCCGCTACCGCCCCCGCAATGAAACGTCCCCGCCAGC
GTGGACCCCCGACGAAGCATTCCGACACCACGAGCCGATATTTAATAAGT
CAGGACAACGACCGCCTCTACAAGCTTAGGGAGGAACAGGGCAAGACTTG
GCAGGAGATAGCAGAGGTCTTCAAGAAGGAGGGGAGGGGAAATCTCACGA
CGAACGTCATTCGTGTAAGATTCTACCGACTGAAGGATAAAGCTGCTGCG
TGGGGCGATGACGAGATTGAGAGATTGAAAGCTGCGATCGCGGACGTTGA
CAGGAGGAAGTGGGAATTTGTGAGTGCGAAGATGGCAGAATTGGGAGGCC
CTGATGCGCGGAGGTTTGCCGCTGCTGCATGCGAGAGGAAGGCGAAGGAG
ATTTAGTTTTTTTATCACTGGAAGT

Sequences in the Contig:

SY0AAA57YE19FM1 SY0AAB17YH03FM1 SY0AAC45YM19FM1