Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1628
Length(NT) : 636
Best Gene Model Blast : Link to GSTUMT00006285001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_07686
Accession: ref|XP_001553273.1| Score: 299 E_value: 1e-25
KEGG Definition: hypothetical protein ( (AL442164) conserved hypothetical protein [Neurospora crassa OR74A] )
Accession: ncr:NCU02039.1 Score: 283 E_value: 4e-24
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1812 Score: 260 E_value: 9e-24
PFAM Definition: IBR, IBR domain. The IBR (In Between Ring fingers) domain is often found to occur between pairs of ring fingers (pfam00097). This domain has also been called the C6HC domain and DRIL (for double RING finger linked) domain. Proteins that contain two Ring fingers and an IBR domain (these proteins are also termed RBR family proteins) are thought to exist in all eukaryotic organisms. RBR family members play roles in protein quality control and can indirectly regulate transcription. Evidence suggests that RBR proteins are often parts of cullin-containing ubiquitin ligase complexes. The ubiquitin ligase Parkin is an RBR family protein whose mutations are involved in forms of familial Parkinson's disease..
Pfam Number: pfam01485 Score: 130 E_value: 1e-08
Swissprot: Q1L8L6|RN19B_DANRE

Sequence:
>Contig1628
TTGGGGAATCGAGGGTACCCTTCTTCCTCCTCCGGCAATTACGTTCACAG
GACAACAATGGCTTTTCAAGGCTCTCTCCACCGCTTCACTTGCATAATAT
GTATGGAATACAAACAGACCTCCTCGGCTAGCCCAGCAATCTCACCTACC
TGCGCTCACCGCTCCAACGTCTGCATGCCCTGTCTTCAAACTTACATCGA
GACAGCCCTCTCTTCCAAAACTGCCACCGACTCTTCCCCACTGCCAAAAT
GCCCTGAATGCCCCAGCGAAATTAGCTTCGAATACGTCCAAGAGACACTC
CCCACCCTCGCGCCCACATACTCTGATCACCTCCTACAAAGGTGCCTCCG
CTCGATACCAGATTACCGGCCCTGCCTGAAACCCTCCTGCTCCGGTGGCC
AACTCCACTCTGGTAGGGACGAGCAACCGATAGTGACCTGTCCGGTGTGC
TCCGAAAAGTCTTGCTTCACATGTCGCATCCCTTGGCATGCATCGCGAAC
ATGCGAAGAGGTGGAGAGTGAAGACAAGGCAAACAAGGAGCTCTTGGAAA
AGTTGACAAAGGTGTGTCCTGGCTGTGGGGCGCGGGTTGAAAAGATAGAT
GGGTGCGATCACATGACGTGCACGTGTAGGAGTGAG

Sequences in the Contig:

SY0AAA26YN21FM1 SY0AAA57YE18FM1