Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1627
Length(NT) : 2614
Best Gene Model Blast : Link to GSTUMT00008091001 E-value : 0.0
Numbers of ESTs : 37

Blast Results:

Nr Definition: predicted protein
Accession: gb|EDR00673.1| Score: 213 E_value: 8e-15
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1627
TTGGAACGCCTTTCCTTCCTTCTCTCTCGAACATAGTCACCCCCCTCGAC
CCCTCGACCCCTCGACCCCCTCCCTCATTCTTCCTCTTCTCTCTATCCTT
CTCTTCTCTGCTCAGTGCACGGTGTTGAACTACGTCTTTATCCATCTACA
GCCTCATCTCTCCTCCCCGCCCCTACAACGCCCCTATCCATCGTCATCAC
TGTGTTTGCCAGCTTTTTCTCTTTGTATTTTCCCTCTCGTCAATCTTTTC
ACTCCTGCCACGGTGGAAAAATTCTTGAAATCTGCTTTCAGATTATCAGC
GGAAATCAGCTGGTTTGCTCACGATAAGGTCTCGTTCGACAGTCAACAGA
ACTGAAAACACCAGCCAACGAGGCTCAACCTAGTTGGCCTGCCCTATACC
GCGTCGTGAAAACGGCAATTCTTCTCAGGAGCGCTACAGGGGTGCCGGAG
ATAGTGGATCTCGAGGGCTCTCACGGTGCGCTAGATTACCATTATTGACG
TCCGAGTAATCACCCACCACATCCCGCCCGCCCCTTGGCTGGTGGATTCG
GAGCCATGGCCAACCAACTCGACCCGCACCACCTGGTGGCTCTGATGTGC
TACGAATTCAGGAGTGGGCAAGATGGTTCTACTCGCCGCTTGGACCCTCC
CTCTGGCCTCACATCCGGCATCGTCGATCACTATGGAACAAACGTTCGCA
CCCGCCCTGTCATGGATGCCCTTGCCCACATATCTGTTTCTCGGCCAAAT
TTTCAATTTGTCGCAATAGCTCTACAATTTAAACACCGTACCAAAGAAAT
TCGCTTGACGATCGCTGAGAACAAAGACGTTGGGGATAGCCTTGTTAACC
ATCTCTACAATATATGGGGAAAGTTGCAGGCTTTGTCAGACGAGTACGCG
AGGCAGAGAGCGGAGGCACGGCATGGGAACCAGGGGACCGAGGAATTGGA
TGGGGACCCGATCCCGTCGCCACCGATCCCCTCGGGGGTGGGACAGCCTT
TGAGGATAAAGATATTTCGCGAGGTATACCAGTACTGCCTGGAAAAGTAC
ATGAAGCGGGTGAATAAGTGGTTGGGAGGTGTTTCTAATTTCATGGAAGA
GTTGTACGAACGCCGTACGGGCGTCGGCCTAGGAAGCTTTGAGCAGGACC
TGTCCAGAGCTGTGATTACGTTGGTGTCGGCACTAAAGCTAGTTTTCAAG
CTCTCTGAAAGGAAACTCACAAATGATGAATGGGAAAACGTATATTGGAA
GAACATGAGTGCTAATAAGAAGGCAAAACTTGTGCTTGCAGATAGCCGCG
GGCTCGGCTGTGAGAGGTTGGCCCGGGAGTTAAAAGGCGACGATCCCGGA
GACCCCTTCCCGCTTCAACGCGCTCTTGAGAAACTGATTTCGTTACCTCG
CCACATTCAATCTCTCTTTGGATTTGCCCATTCTCCCAGCCTCCGGCCCG
CCTTGCAATACCGTATGACGATTTGTGCTCTCCTGGGCCAGGCTCAAAAC
GTAAAATTACCTGCATCGCAGAATGAGTGGAAGTCCTTTTTGAAGGTTGC
AAGTGGTGAGGAATACCTGTGGCAGGAGGATGATGCAAGGAAGCTATTTA
AAAAGTTTGGGTCGCGAGAACGGGAGTGCCCAGTCCATTGCGAATGTGGG
CTTATTCAGTACCTCCAAACTAAACATTATGATTCATGGGACAATGTCCC
TGCGTTTAGCTACATTGGAGTCTCCAAGTTAAGCTGCAGTGCCTGCCACG
TCTGGATAGAAGCCTTCAACGAGCTGGGGGGACCAAAGTTTTATACCCGA
GGCTCGCATGGAAAATGGTATTTTCCTTGGGGGATGCCCATGGCGGAGGG
GCCCTTGAAGGAGAAGATGAGAGAAAAGGTTTTGAATGAATACATCACGC
AGCTAGAGGATGAGGGGAAGATTAAGAAGAGAGCAGGCTCGGATAGCAGT
GGCGCGATCTCATCTGGGGCAGAGGACAATATGGGCGATGATCGCTCACA
AAGCACTGATGCTATGGTTGACGCAGATGTGCAAGAGTCCGGGGGAGACC
CGCGGGGGTTTCTTAAGGTCAATGTCCCTGGTTTGGAATGGCGAAGCCCT
ATTGAGGGGGGAGACCGGCAACATGAGCCGGGGCCGAGTGATATTTGGGA
AATTCTGGGATAGAATACATAAATAACATAGGAGGGGGGTGTTTGGTCTG
TTTGCTGTGCTTCCCTGCTCGTTGATTCCCCTCCTATATTTCAGTGGTTT
GGCGACAAGCTGACCCTTTTTTCTTTTTCTTTTTTACTTTCTCCCTTGGT
CCAATGGGTGGAATTTGAGGACAACAACATCTAGAAACTGGCTACCGTAT
GCACTTGTCTGCGCATTCTACGAGTATCACCTGCTTTATTACCTCGTGAT
CTGATGGTGGGTTGAGCCGGCATTCCTTGGTAGTTGGCGTCTATTATGCT
GGAGATGGGACTCTTTCGTTTTTGTTGCTTCATAGTAGTTTCGTTTTCTC
TCGTTTCGTCCCTGTTGCCATCACACAAATGGGATGGTGTATTAAAAATA
TGCCCCTGTGATCGATAGGATGTGTGTATGTGGTCACGCCCCCATTTGGG
AGGTTTTGCACTTG

Sequences in the Contig:

SY0AAA57YE17FM1 SY0AAB22YM05FM1 SY0AAB2YK11FM1
SY0AAB4YD19FM1 SY0AAC13YL11FM1 SY0AAC15YJ24FM1
SY0AAC19YN05FM1 SY0AAC21YE20FM1 SY0AAC21YE20RM1
SY0AAC23YK12FM1 SY0AAC25YK20FM1 SY0AAC25YK20RM1
SY0AAC28YK17FM1 SY0AAC31YN12FM1 SY0AAC36YJ12FM1
SY0AAC3YE02FM1 SY0AAC3YN19FM1 SY0AAC40YL24FM1
SY0AAC44YO15FM1 SY0AAC48YP18FM1 SY0AAC4YA15FM1
SY0AAC4YN02FM1 SY0AAC56YH14FM1 SY0AAC60YB23FM1
SY0AAC61YC19FM1 SY0AAD11YH13FM1 SY0AAD17YO20FM1
SY0AAD18YO20FM1 SY0AAD19YK23FM1 SY0AAD27YH19FM1
SY0AAD2YG17FM1 SY0AAD31YP03FM1 SY0AAD33YJ08FM1
SY0AAD34YI18FM1 SY0AAD41YL02FM1 SY0AAD5YM05FM1
SY0AAD9YP01FM1