Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1626
Length(NT) : 1365
Best Gene Model Blast : Link to GSTUMT00008899001 E-value : 1e-177
Numbers of ESTs : 11

Blast Results:

Nr Definition: transcription elongation factor S-II
Accession: ref|XP_001559693.1| Score: 621 E_value: 2e-62
KEGG Definition: hypothetical protein
Accession: ang:An02g12503 Score: 590 E_value: 3e-59
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1105 Score: 592 E_value: 1e-61
PFAM Definition: TFIIS_M, Transcription factor S-II (TFIIS), central domain. Transcription elongation by RNA polymerase II is regulated by the general elongation factor TFIIS. This factor stimulates RNA polymerase II to transcribe through regions of DNA that promote the formation of stalled ternary complexes. TFIIS is composed of three structural domains, termed I, II, and III. The two C-terminal domains (II and III), this domain and PFAM:PF01096 are required for transcription activity..
Pfam Number: pfam07500 Score: 233 E_value: 4e-20
Swissprot: P49373|TFS2_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig1626
TTGGTGAAGCTTAGAGTCACTTCTTTCCCTCTTCTCCACCCTAACTATCG
ACGTCTTACGCCCACCAGTATTTAATACCAGTATTCACACCGGCCCCCTT
GTCCCTCCCCCTCGTTCACTCTTGCTTCTCTCGGCATTCTCTCGTTTATC
CTGTCCCTTCCTATATCCTGCGGGCCATCACTCACAGCCTCCCCCGCGGC
AAATTTCTCGCCTTTCAAAAGCTATCGCATCATGGACGCGAAGGAAGTCA
AGACACATGTCACTAACATTGAGAAAGCCGTTAAAGAGAAGCTTCCCCCA
GCGGTTTTAATTGACATTCTGAATTCGCTGAGGACCGGAGTTACCGCTAC
TGAGCAGCTATTGAGGGACACGAAAGTTGGCATGGCTGTCAACAAGCTGC
GTATGAACAGTGATAGATCTGTCTCGGACCTTGCCAAAGAAATCGTCGCA
AAGTGGAAGAAAGATGTTCATACCAAAACCAAGCCCTCCGGATCGTCCTC
CCACGATGGCAAGAAGGAGCGCATGGTCACCGTATCTCCATCCAGAACTC
CCCCTAAACCTTCCGGAAAACGCCCAGCGGATCTTGCCACTAGATCTAGA
AAAACCGACAATGTTAATTGGCAGTGCACCGGCGAAGCTACTCGTGATAA
CTGTCTTGGCATCATTTATGACGCGTTGGCACTTGGTTGTGATGCTTCTT
CGGATACTCTCCTATCGCTAGCAAAGTCCATTGAGTCCATCACCTTCACA
AACTACAAGAAGACCGACGCAGCCTACAAGCGCCGCATGCAGGTCCTCTT
CCTCAACCTCAAGAGCAAGGACAATAATCTCCGCAACCGTGTTGTCTCAG
GCGAGATCACTCCCGCGCGCCTCTCCACCATGGAGAGCAGCGAGATGGCG
TCCGCACAGAGGAGACAGGCCGACGAGAAGCTCATGGAGGAGAACATGAG
GACCGCCATGATGGCCAAATCCGAGAAGTCTATCAGCGACCAACTCACCT
GTGGAAAATGCGGTCAAAAAAAGGTTTCGTATACCCAGGCGCAGACCAGA
TCTGCCGATGAACCTATGACTACATTCTGCACCTGCGAAATTTGCTCTCA
CCGCTGGAAATTTTCGTAGATTTTATCTTGATCGTTATTCCTTTTTTCTT
ATATACATTTATCCTCTTGCGTATCCGATGCATCCTTTCCTCTCCTTTCC
TCTCCTTTCCTCTCCTTCCCTCTCTCTTTCTCTCCCTTTCTCTCCCTTTC
TCTCCCTTTCTCTCCCTTTCTCTCCCTTTCTCTCCCTTTCTCTCCCTTTC
TCTCCCTTTCTCTCCCTTTCTCTCCCTTTCTCTCCCTTTCTCTCCTTTCC
CCTTCCCCCTTCCGT

Sequences in the Contig:

SY0AAA35YO17FM1 SY0AAA3YF19FM1 SY0AAA57YD21FM1
SY0AAA61YB12FM1 SY0AAA6YO10FM1 SY0AAB55YJ11FM1
SY0AAC18YC08FM1 SY0AAC39YF19FM1 SY0AAD29YK21FM1
SY0AAD33YJ06FM1 SY0AAD44YL01FM1