Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1625
Length(NT) : 649
Best Gene Model Blast : Link to GSTUMT00003915001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: ubiquitin fusion degradation protein UfdB, putative
Accession: ref|XP_001271626.1| Score: 134 E_value: 2e-06
KEGG Definition: ubiquitin fusion degradation protein UfdB, putative [EC:6.3.2.19]; K10597 ubiquitin conjugation factor E4 B
Accession: afm:AFUA_4G07340 Score: 133 E_value: 1e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1625
TTGGGTTTGTCACAGAGCAGCAACAACAACAATAATCTTCACTCGTAACC
CATAAAGAAACCCGTTTAACTTTACCTTTATATATCTATTCGGTTTTACG
AAAAAGAAATGTCCTCTAATCCTGAACCGGATGCAGATGCGATTCGCGAC
AAGCGACTTGCTAGGCTTGCACGACTTGGGGGATCCTCTTCGCCCAAACC
CTCTGCCATTCCCCGCGATGGAGAAACGAGCATGTCCCAGTCTGTCGAGC
AAGAGAAAGTAGCTCCGAGACCTCAGCCCCTGGCTCCTCCCATCACAGGT
CTTATCACAGGGACGCCTACAAGTCAACTTCTGGATAGACCATCGGGCTC
GACGTTGGAAGGAGTAGTTACATCCCCGCTTTCAGATACACCTTTGGCGG
AAACGTCGTTACAAACTCAGCCAGCCGCAGGCAATCCCTCTTTAGGCGCC
CTTATGGCTACGGAAGCATGGGAAGATAAGGCGCTGAGACAGATATTTCG
AGTTGCTCTGGAGCCTGGGCCCCGCTCGGCTGGACTGTATGTCTTGGATG
ATCTCCGTAAGGAATTAGAAGAACAGTTGGATAGTGAAGGTAAACGGCCA
CGCATTGACGTTACGATCCTTGATCAGTTAATACTCTCAGTATGCGCTA

Sequences in the Contig:

SY0AAA45YC18FM1 SY0AAA57YD15FM1