Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1621
Length(NT) : 1393
Best Gene Model Blast : Link to GSTUMT00010242001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein SNOG_12848
Accession: ref|XP_001803066.1| Score: 938 E_value: 3e-99
KEGG Definition: Cl- channel CLC-3 and related proteins (CLC superfamily); K05393 chloride channel, other eukaryote
Accession: aor:AO090011000806 Score: 933 E_value: 6e-99
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0475 Score: 573 E_value: 2e-59
PFAM Definition: Voltage_CLC, Voltage gated chloride channel. This family of ion channels contains 10 or 12 transmembrane helices. Each protein forms a single pore. It has been shown that some members of this family form homodimers. In terms of primary structure, they are unrelated to known cation channels or other types of anion channels. Three ClC subfamilies are found in animals. ClC-1 is involved in setting and restoring the resting membrane potential of skeletal muscle, while other channels play important parts in solute concentration mechanisms in the kidney. These proteins contain two pfam00571 domains..
Pfam Number: pfam00654 Score: 339 E_value: 2e-32
Swissprot: Q5RBK4|CLCN5_PONPY
Gene Ontology:
GO:0010008 = Cellular component: endosome membrane
GO:0000139 = Cellular component: Golgi membrane

Sequence:
>Contig1621
TTGGCTCCTATCTCGCTCCTCTCGCCAAACCTTCCACCATCCTACCCGAG
TTTCGTGGTTTGTTCGCAGTGGTTTCGCTCCCCTTACTGCCCCTGCTGTT
ATCTAGTGCGAGGCTTTTGCTACCCGTCTGCTTGGATCATGGCCGACGAC
ATCGGAAGTATGCCTGGTCAACGCCGGGTCCCGGAGAGAGATTTGAAGGC
CGGAAGGAGAAGTCGTCGAAGACTCTCTGCTTCCTCCAGAGATAAGGATA
CCGAGCAGGACGAACAGTCTGGCTTGCTTGGAGGATCATGCTCCGGGGAT
CAGAGGGACTACCAAACAGTCCCGGGGACCCCTCGACATAGACTTTCCCG
ACATCACTCCTCACATTCTCCTATGGCTAGTCGTCCTAGCAGAGTTCCGT
CATTCTCACAATGTTTGAGCAGGGCCCTATCGAACTACGATCTCAGAGAC
AGGAACAATGAGTCACTTTTGGAGGATCGGGTTTGGTATGATCAGTTCAC
CTCTACTGATTGGATTAACGACTCGATCAAGGATGCCCACCGAGTGAGGG
CTCTGAGGGCTCGCAAGGATTTCCGGGGCAGAGTCTACGCTTGGTTCGAC
GGTGCCCAAGGATGGGTTCTGGTTGCGATTATTGGCTTTGTGACGGCCTC
CATAGCCTTTTTCATAGACGTTACGGAGAATGTCCTATTCGATTACAAGG
AGGGGTATTGTACGAATGGGTGGTATTTTAGCAAAAAGAAGTGCTGTTTA
AGTGATACCACGAATGAATTCTGCCCTATGTGGCGCTCTTGGTCACAGGC
AATTACGAAGTCTGAAGTGTCTACTGAGCGCATTGACTATATCGCATATG
TTACGTTGACGGTGATCCTAGCTACCGCTTCATCGCTACTCACCATGACT
ACTCGCACGGTTTACCCTGGGACCCTGCGCATCCAGACCGTAGACGAAGA
CCTCTCGCAAATTCTAGGTGGAAGCTCCGGTGCTGAAGCGAAGGCTGCTG
TTGCTTCACCGACTGTTTACTATTCTGCTGCTGGCAGCGGTGTGGCAGAA
GTCAAAGTGATTTTGTCCGGATTCGTTCTCCACGGGTATCTCGGTTTAAA
GACTCTTGTGGTTAAATCATTCGCCTTGATTTTGAGCGTTGCTTCTGGGC
TGAGTTTGGGGAAGGAGGGGCCATATGTTCACATCGCCGCTTGCGTAGGA
AATATTGCTTGTCGTCTATTCTCCAAGTATAACCGCAACGACGCCAAGCG
TAGGGAGGTTCTGAGTGCTAGCGCGGCGAGCGGGGTTGCGGTTGCATTCG
GTGCCCCGATTGGTGGGGTCTTATTTAGTCTCGAGGAAGTCAGCTACTTC
TTTCCTTCGAAGACCCTGTTCAGGACTTTTTTCTGTTGCATTG

Sequences in the Contig:

SY0AAA18YH20FM1 SY0AAA57YB24FM1 SY0AAB15YK11FM1
SY0AAB54YL22FM1 SY0AAC22YA19FM1 SY0AAC26YL17FM1
SY0AAC46YC13FM1 SY0AAC7YJ04FM1