Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1620
Length(NT) : 936
Best Gene Model Blast : Link to GSTUMT00003625001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_06088
Accession: ref|XP_001593166.1| Score: 553 E_value: 8e-55
KEGG Definition: hypothetical protein
Accession: ang:An04g05060 Score: 483 E_value: 5e-47
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2462 Score: 258 E_value: 3e-23
PFAM Definition: No Hit Found
Swissprot: P08045|XFIN_XENLA

Sequence:
>Contig1620
ACTTTCAACAACTACTTCATCAACCCACTCTCGTTTTCCTCCCTCTTCTG
CTTTTCCTGTTTATCGACCTGCTCATAGAGACTTTTCATTGGAACAAAAG
AGAAAAAAGAAAAAAAAAGAGGGCAAAAAAAACTTGATACTTTCAAAACT
GTTTTACCTCCATATTAACACCATCTCTTCGCTATGGATATTCTTGAGTT
GATCGATGATCGTGAACAAACTGTTGCCGAGTCGAGTCCTCGTCCCTTCT
GTTGCCCTGAGCAGAGCTGTAATAAGAGCTTCAATCGCAAATCTGATTTA
CAGCGCCATCACCGGATACATACGAATGAGAGACCGTACTCCTGCACCTT
TCCTAATTGTGGGAAATCCTTTATTCAGAGGAGTGCCTTGACCGTTCATA
CCCGAACACATACTGGCGAGAAGCCCCACTCGTGTGAATATATTGGATGT
GGAAAATGCTTCTCAGATTCCTCTAGCTTAGCTCGACATAGGCGCATTCA
CACGGGGAAGCGGCCTTATAGCTGCCCCATTGACAAGTGCGGGAAAAGTT
TCTGTAGGAAGACAACTTTGACAAAGCATGCGAGAAAAAATCACCAACTT
CGGGCAGAAAATGATGTGTCGGATGATGATGTAGAGGAGAGTGATGATGA
TGATCTCTCGCCTAAAGCATCAGGCAAGGCTGGATCGCGGGCTCAGTCGA
AAAGGTTGACGAAAGCTTCAGCTAGGAGAGCAGCTCCTCCTTCAGCTCCT
AGTCGCCCTAGCGTTCTGCGAACAAGCTCTTTTGCTGAGCCCCTAACTCC
TCATAGTCCTCAATCCACTGTCAGGTCCGGACATTCAAGTCGAAATACGA
GCTTTTCCGCAGCTTCAGATTCATATCGTCACTCAATGCCTATGGCCATG
ACGCACTCCGTGCATCAACATCAGCCGCCGACACCC

Sequences in the Contig:

SY0AAA2YI14FM1 SY0AAA57YB21FM1