Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig162
Length(NT) : 1112
Best Gene Model Blast : Link to GSTUMT00002421001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212393.1| Score: 596 E_value: 1e-59
KEGG Definition: predicted protein
Accession: aor:AO090009000244 Score: 593 E_value: 1e-59
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig162
TTGGGGCCAACAAGTATTCTCTCTTGGCGCCAACCCATCCATGAGATCAA
CTCCAGTAGTCGCTGATTCCGTTCAGCCGTCCGTCCTCGACGCTCCTTCC
AACGTCGGCTCCAACCTCTCCCATCGTCAAAGTCCTCTTCCTCAGTTAGC
TGCGAGTGCACTACCAGAGTTTGATGATCCGATGCCTGAGTATGGGCGCA
TGGCCGAGGATGATGAAGAGATCAACACCAACCCCTCAATAATACAGGGC
CCCGGACGTGAGCCCGAAGACTGGCGTTTCGACCCGCCAGCTCAGTCGGC
CAATGAGCTTCATCTTGGCGGCGACCGTGGGATGGGTGCAGATGACAACT
TACCCCCATCGCTTAGAGCAGGCCAAGGCATGTCACCAACTTCACCAGCA
CTTAAAGACGAGGGCTACATCTCTGCAGCAAATCCGGGGATGGCCTCGCC
TAGTCCTATGACGCCTGTTCAAAACGTGGGTGATCCGTCTATGGGGATGG
GAGCGATACGTGGCACCGGTTCTGAGGACGACAACTATTCATATCACGGT
CACGCAAGGATGGCAAGCGGGAATTCTCACGGAATGCCTTCACCATTATA
TGACAGCTCGACAGGTAGGGGTATCGACAGAATTCAGTCAAGGGACATCG
TCGCTTTGATGGATCACCTCACCGTTCGCGATGCGCAACGAAACGCGCGA
GACACCGAGATTTTAGTCACTCTTGTCCGGAGCGCAGCGGAGATGAGGAA
CTCTTTCGAAGATATGAAAAAGACTCTTGAATCGCAACAACATGCAATCA
TAGATGGCGTCGACCAGAATACCGAGAGAAGTGTTCAGAAGGTCCTTCAA
GGGCCGCGACCACTACCCCCATCCGCCCCTAGAGCACCTCGATATCCCAA
GAACGACGACGATGCTGAGGATGAGGGCCCGGCTAAGAGACGCAATGTTT
TCCGCAGAGCGCTTAAGGGGCTCAGCATGAGAAGCTCCAACGACTTACAA
AGGATCGAAGAGATGCTGCAGACTCTTTTGGGAGAAGTGGAGGGATTAAA
AGGAGGCCAGAATTTTTATCAGCAAAGCTTGCTGCAAAGTCAGAGTATGG
GAACCTTCGACG

Sequences in the Contig:

SY0AAA10YD21FM1 SY0AAA15YO01FM1 SY0AAC19YA09FM1