Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1617
Length(NT) : 573
Best Gene Model Blast : Link to GSTUMT00002428001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_09093
Accession: ref|XP_001590328.1| Score: 186 E_value: 1e-12
KEGG Definition: hypothetical protein
Accession: ani:AN2268.2 Score: 179 E_value: 4e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1617
TTGGGATCCCACCAACCAACCCAATCATTGTACCAATCCGTGGGAAACGC
AACAAATAGCAATGGCCCACCGAACCCCCCCGAGCTTCCTGTGGGCGCCA
AACACCCACCACCGCCTCCTCCTCATACCAGGAAACGCCTTCCACCAGCA
ATCACTCAAGCTCAGCACGACAAAACCCGCCCTGGCCCGAGTACCCCCGG
GGGAAAAGATCTCCGCATCCTCCCCGTCAAAGGGGGGACCACGCACCCGC
GCGAAGTACCAGTACCGCTCACCACGGTACTACCGCGGTCGCTTGGCCCC
GAACATGCCGCCACCGTCGGCCTCTCCCTCGTCCAGGTTATTCGTACCAG
GGCCTTTCGCCGCAGAACGACTCGAAGACCACTACTGGAACACCATAGCC
CCCGACTTACAAGTCCTCTCGTACGTGCACAAACAGAACCCGACTTTCAA
CATAGAAAAGGACTACCGACAGCTCACGGCATTGCGTCTCCCGCCGAAGC
CCACCCGTCAACAACTCCCCGCGCTGCGCACCTTTCGGAATATTCCGCGG
TTGATGGGAATCACCGTGCACTC

Sequences in the Contig:

SY0AAA57YA14FM1 SY0AAD14YI11FM1