Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1616
Length(NT) : 1702
Best Gene Model Blast : Link to GSTUMT00006320001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: hypothetical protein NCU09899
Accession: ref|XP_958624.1| Score: 222 E_value: 5e-16
KEGG Definition: hypothetical protein
Accession: ncr:NCU09899.1 Score: 222 E_value: 2e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1616
CTTAAAGATAACATGAGGGGAAGCACGAGGTTAGAGCGCACGCCACACAT
AAACTACTCGAGTACCAGTACTCGTACAGTAAGTGTACTCCAGTATTATT
ATCCCATAAGGTCTCGCGTGGCTCCCTGGCCCATCCCTAACTCATAATCA
CACCCACAATTACAAGACAATCACCACCACTCACCCCCCGGTTCATAAGC
TCCACTTCTCCCGCACCTCCGCCCCCGAGCTCAAACTGTTGCCAACAAAC
TCTGCTCCTAACGACACGCGATAACCGCAGCACGCCTCCAGGAAATTTTG
CTGGAGCAGAGAGGCTCGAATTTCAAAATAAACATCCCCGCGAAGCCTCG
GTCCACAAGAGAGCAGATCTAGCGCTTCTACCGCTAATTCGTCAACTTCC
GTAGATCTTGTAAACAGATCTGCGAGACTGTCTTGGACTCAAGCTCTCGT
TTAAACCACCCGCCCAAAAAAGTGCCAGGTCCGCCTCACGGTCCTTATTT
TGTGCCTTACCTTTTCGAGGAGTCCCGCCCGCTTTTCATCTCTCGAATCC
GGGCCTTCTTTTCTTTTTTACATACACCATCCCCTCTAACCTTGTCTGTT
GGGCCCTTTCCCTCACTCACCCTATCGACGATCTCCCACACCCTCAACGC
AAAAACCCGCTTGGTGGGATTGGTTGTGCTAACAGCCTTCGTGGAAGTCA
TTCCCATATAGAAGGCTGGCCTGGTCTTGAGAGTGCTGCTTTCTTTCTTC
CTTCCTCCTTTCCCATTCACCCTCCAGAAACAGCTTTCTGTATTACATGT
CACAGAAGTAACCGGACGCCTCCCTTTCCTACAAGGAAAAATAATTGGAA
GCCATTCCATGGTTCCCACAAAACCAGACACTCACCCACTATATAATCCG
ACGCCCATTCCAACCCAGCAAGCCTCATCTGAGTCATCATGTCGGTAGTC
TCAATAGAATCGAGTATCGACAGGGCGAAGAAACTCGTCAGATCCAAGAT
ACGGAGTATGATGGACGAATGCAAGATTCGGAAGTTTGCAATGGAACTTC
ATTCTGGGTTGTCGTGCTATACCGCTCGGGAGTCTGGATATAGGGAGGTA
TTGAGGATGGCTCGAAAAACGATTTCTTTTCTCCGTCCAGGACAACGGGC
GGCAGCCTCGACCCGGGGTGGTACTACCACCTCCAAAGGGTTTGTTCTTC
AAAAGCCGCGGGTGCTCTGTTAGAATCGTGCCCCTTGCTGACTTCTTGCA
TCTCAGCTCTCGTTCACTAGGGGCTTTGTTCTTCGGCCTTCCAGTTGAGC
TTCAGTTGGAAGTCGTTAATAAGTTATGCTTCTTTGATCTTCTGTCATTG
CGGAGGACATCACGGAAATTCAGAGAACTCACAATGCACAACGAGAGCCA
TATAGTCAGGCACCATATCGGCCAGTGGGTGCCGTTACATATCATGAAAC
TATACCCTCCTCCCACAGATGTGCCACCGACGCTGGGATACCTCACTGAC
CTGGCATACAAACAACGGGTATCAACGCATTTGGCGCTGTCGTTAGCACG
CCAAATTGTGAAAGAAATGATGGGAGGGCGGCAGTCCCGGAGAATGTCGA
AAGAGGCCACGGTATATGTTTTGAATCAACTACGGTTAGGAATGGCACCA
CTGATATTCGCGTTATTCCACTTTTTCGAAACGTACAGAACGCGGAGACT
AG

Sequences in the Contig:

SY0AAA42YN18FM1 SY0AAA56YN20FM1 SY0AAB14YM03FM1
SY0AAB38YG02FM1 SY0AAB50YJ10FM1 SY0AAB53YH15FM1
SY0AAC10YJ18FM1 SY0AAC46YA04FM1 SY0AAC5YA22FM1
SY0AAD45YE12FM1 SY0AAD49YD17FM1 SY0AAD55YE21FM1