Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1615
Length(NT) : 1942
Best Gene Model Blast : Link to GSTUMT00001930001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001244777.1| Score: 2374 E_value: 0.0
KEGG Definition: translation initiation regulator (Gcn20), putative; K06158 ATP-binding cassette, sub-family F, member 3
Accession: afm:AFUA_4G06070 Score: 2319 E_value: 0.0
KOG Definition:
Classification: [Amino acid transport and metabolism, Translation, ribosomal structure and biogenesis].
Kog Number: KOG0062 Score: 1757 E_value: 0.0
PFAM Definition: ABC_tran, ABC transporter. ABC transporters for a large family of proteins responsible for translocation of a variety of compounds across biological membranes. ABC transporters are the largest family of proteins in many completely sequenced bacteria. ABC transporters are composed of two copies of this domain and two copies of a transmembrane domain pfam00664. These four domains may belong to a single polypeptide, or belong in different polypeptide chains..
Pfam Number: pfam00005 Score: 305 E_value: 3e-28
Swissprot: O59672|YB89_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig1615
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTCCGAGGCTTCTGTCACAG
GCTTAATAGATAAGCTTGTTGCTCAGCTCAATGCTGCCCACGGCGAGAAC
CGAAGAGCTTTTTCTGGCCGAGCAAAAAAGCTTGATCAAACAATCCACAT
GGCCTCCCAGAAGAACATCTCCTCTACAATGGGTTTAGTAGGCGGTGGTG
TCGACATCGATGCAGTGGGAACAAGGAAAGTTGAGAGTAAGGTCGACAAG
AAGAAGCTCGAGAAAGCAGAGCGAAAGATCAAGGCGAAGCAGGATAAGAA
AGTGATGAAGAATGTGACTTATGAGGCATCGAAGTTAATTGCTACAGATG
AACAACAGTCTTACGATGACTTCTACATGGCTGTCAATCCGCTCCAGCTC
GGGCAGAGCTCGCAGGGCAAGAGCAAGGATATCAAGATTGATAATGTGGA
CGTGCAAATCGGTGGGAAGAGGATTTTGTCAGATACTACACTTACTTTGG
CTTATGGGAGGCGATATGGCCTTGTTGGGCAGAACGGTATTGGTAAATCT
ACGTTGCTTAGAGCGCTGTCGAGACGTGAAGTGGCTGTCCCTACACATAT
AACCATTTTACACGTAGAGCAAGAGATCATGGGTGATGACACTCCGGCAC
TACAAGCCGTGCTCGACGCCGATGTGTGGCGGAAACACCTTCTCGCAGAA
CAAGACCGTATCTCAAAGGAACTCAAAATACTCGAGAGCAAGCCCGACCC
GATCACCATCACCGCAAGTCAGGGATTCCCGAACCAAGAGCGTGACGAAC
TGGACTCGCTACTGTCAGAAGTCCATGCCAAGCTCGCCGAGATTGAATCC
GATAAGGCGGAGCCAAGGGCTGCGTCCATTTTGGCAGGGTTAGGGTTTTC
GGCGGAACGACAGCAGGATCCTACCAGAACCTTCTCCGGAGGTTGGAGGA
TGAGGTTGGCGTTGGCTCGTGCCCTCTTCTGTAAGCCGGATCTTCTGCTT
CTGGATGAACCGTCGAACATGTTGGATGTTCCGTCAATCACTTTCTTGTC
CGAATATCTGCAGGATTATCCCTCCACGATCCTGGTCGTGTCTCACGACA
GGGCTTTCCTGAACGAGGTTGCGACTGATATCATCCATCAACACTCTGAG
CGTCTCGATTACTACAAGGGCGGTAACTTTGACTCATTCTATGCTACCAA
GGAAGAGCGACGGAAGACGGCGAAGAGGGAGTACGAGAACCAGATGGCGT
ATCGGAAGCATCTGCAGACCTTTATCGACAAGTTCCGGTATAATGCTGCC
AAGAGTAGCGAAGCCCAGAGTAGGATTAAGAAGTTGGAAAAACTGCCGGT
TTTGGAGGCCCCCGAGGACGAATATAGTGTTGTGTTCAAGTTCCCGGACG
TGGAGAAGTTGAGCCCCCCTATCATTCAGATGCAGAATGTATCGTTTTCG
TATACACCTGGGAAGCCAATTGTCGAGAAGGTGGACCTGGATGTCCAGTT
AGATTCGCGGATTGGTATTGTGGGGCCTAACGGTGCCGGTAAAACTACTG
TTTTGAAACTGCTCATTGGGCAACTTTCCCCATCAAGCGGGCTTATCACC
CAAAACCCCCGGCTCCGAATCGGCTTCTTCGCCCAGCACCACGTCGATGC
CCTCGACCTGAACTCCAGCGCAGTAGCCTTCTGCGCAAAAATGTTCCCAG
GCAGAACCGACGAAGAATACCGCCGCCACCTCGGCGCCTTCGGCATAACC
GGGACGACAGGCCTCCAAAAGATGGCCCTCCTCTCCGGAGGTCAAAAGTC
CCGTGTGGCATTCGCCTGCCTCTCTCTGACGAACCCACACATCCTCGTCC
TCGATGAGCCTTCCAACCACTTGGACGTGGAAGCCATGGACGCGCTCTCT
AACGCGCTGAGGAATTTCCATGGAGGCGTTCTCATGGTCTCG

Sequences in the Contig:

SY0AAA12YB03FM1 SY0AAA46YG15FM1 SY0AAA56YM20FM1
SY0AAC36YA12FM1 SY0AAC37YF04FM1 SY0AAC42YA11FM1
SY0AAD30YN07FM1 SY0AAD5YE11FM1