Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1614
Length(NT) : 733
Best Gene Model Blast : Link to GSTUMT00005689001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_07330
Accession: ref|XP_001554193.1| Score: 546 E_value: 3e-54
KEGG Definition: hypothetical protein
Accession: mgr:MGG_08887 Score: 474 E_value: 4e-46
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O13818|YEE2_SCHPO
Gene Ontology:
GO:0005635 = Cellular component: nuclear envelope

Sequence:
>Contig1614
TTGGCCCAGCTAGAAGGAGGAAGTATGAGGCGGGAATTTAAATACCAGAT
CGAATACCTCGACATTTTACGGAGATTGCGGATATCAAATGTGGTTGATC
ATCAAACGATTGAGAAACAAGACGATCATTTATGTTATGTAATCACGGAC
CGAAAAACACCCTGGCATTTGCCTCACCGCGAGCATTTCATGCTTGTCAG
CAAGGTGGTCATTACTCACTTAGCGAAATCAAAGTGTAAATTATCCATCT
GGACTGCTGTCGAGTGGGCAAAGGAGCCGACTTTCTCAAAGGGAATTGTT
CACAGACAGGCCCTCGATGACCTCGACTTAGACGCCCTCGACCTGGGAGA
CGTCGTCGCAGATCAGGCACGGAAATTAGGTTCTCCAAGCCGCATAGAGA
ATGCTGTGCACATCTTTGGAGGGATAGGCCAAGAAACCCCGGGCTCCCAT
CTGACAGCGGGGGGACCGGACGGTGCGCCTCTCGCCCCAGATCTTGACCC
AAGAGCCCCGAGGTTACCGATCGCCCACAGATCCCTCTCCCAGATGATGT
TGGAAACTGGCTTGAGCTTTCTTGAGAGCGCAGTGTCTAGCCTTATGATG
TGGACATTCACGGCTCTCCAAAAAGCCTGGGGAATTGCTTCGGCGCAGCG
CATTATCTTATTGTTTCTGGCTGTGTCTCTCTTGAGCAACACAATGCTTA
GCTCGAGATCTACAGTTTCATACTGGAATGAAA

Sequences in the Contig:

SY0AAA56YL21FM1 SY0AAB11YO20FM1