Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1613
Length(NT) : 831
Best Gene Model Blast : Link to GSTUMT00005967001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001209359.1| Score: 587 E_value: 7e-59
KEGG Definition: metallopeptidase
Accession: aor:AO090102000142 Score: 579 E_value: 3e-58
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2776 Score: 374 E_value: 9e-37
PFAM Definition: Peptidase_M24, metallopeptidase family M24..
Pfam Number: pfam00557 Score: 168 E_value: 6e-13
Swissprot: Q09184|CDB4_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1613
TTGGACCATTAACCTCCTCCTCCCCTTTCGAAATTTCCTCCATCAAAAAG
CTCATCGAAAACAGACTAACGGATACCAATACATCTGATGACGGACAAGA
AAGAGAAGGCAGACGGGCCCGCTGCTGCCGAGAGTAATCCTGAAAACGAG
TTTGCGCTTAGTCTTACAAAATATAATGATGCTGCGGCGATTTCTCACCG
AGTCCTTGCAAAGGTCTGCCGACTTGCGATTGACGGGGACGGGAAGACTA
TATTGAGCTTGTGCGAGGAGGGTGACAAGTTGTTGGATGAGGAGTGTTCG
AAGGTTTATAAGGGAAAGAAAATTTCCAAAGGGATTGCTTTCCCCACGAC
TGTTTCTCCAAATGATATCCTTACACCATATACTCCTTTGGCGACCGATC
CCGGGGAGAACGAGATTGCTATCAAGAAAGGTGATGTTCTAAAGATTCAA
CTTGGTGCTCAGCTAGGCGGTTATCCTGCGATTGTCGGGGACACGGTTAT
CGTCGGTCAAGATGCGGAGCTTACTGACGACCAGAAAAATCTCCTCCAAG
CAACCCACTATTGCAATGAGGCGCTATTACGTCTTCTCCTCCCATCCGAA
ATTCACCCACTGACAACTCCCGAAAAGCCACACAGGCAACCTTCCGCCTA
CGAGATAACCCAGATTCTCAACAAGATCGCTGCAGCCTACGATTGCACTA
TCGTCGAATCCACCACCTCGTTTAATTTTCTCCAAAATGAGATTGAGGGA
AAGAAGCGCCTTGTGCTACATCCCGGTGAAGGTATGCCGAAGTCTGAGGG
AGCACCTGAAGTTGGTGACATCTGGGGTGTG

Sequences in the Contig:

SY0AAA19YP12FM1 SY0AAA56YL16FM1 SY0AAB41YB17FM1
SY0AAC12YJ19FM1 SY0AAC32YD17FM1 SY0AAD24YP10FM1