Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1612
Length(NT) : 868
Best Gene Model Blast : Link to GSTUMT00002592001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: DUF895 domain membrane protein
Accession: gb|EDP48896.1| Score: 613 E_value: 8e-62
KEGG Definition: DUF895 domain membrane protein
Accession: afm:AFUA_8G04110 Score: 613 E_value: 4e-62
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3098 Score: 328 E_value: 2e-31
PFAM Definition: DUF895, Eukaryotic protein of unknown function (DUF895). This family consists of several hypothetical eukaryotic proteins of unknown function..
Pfam Number: pfam05978 Score: 162 E_value: 4e-12
Swissprot: Q5RCQ5|MFS11_PONPY

Sequence:
>Contig1612
TTGGAAAGGATATCCAGATCTTCCGCAAATGAATCACATGCCCATGCAGT
GCAGGTATTGCCGTTAAGCCCAACAGAAATAGAACTTTTTTCTATATTAT
CTCCCCATCCCGACCGCTATTTGCTCCTCTCCCTTGAACCTCGATTTTAG
CGACTTTGCTAAAGGTCTACGAAACAACCACAAATGACAGGAGGCGAAAT
AACGACAAATGCCACTCCTCCGGAGCAAGGGGCTATGGAGACACCTCATG
AGGATAATTTTTATCAGAGGAAGGGGATAAAGATCTTGGGCATTCGGTTG
CCGCCGTGGCGTTCGCCATTGGCTCAAGTGATGCTCACCGGCTTCGTCTG
TTTCCTTTGCCCCGGGATGTTCAACGCGCTGAGCGGTTTGGGTGCTGGTG
GCCAAGTTGATAGCAGAGTCCAATCCAACGCAAGTGTGGCTTTATACACC
ACATTTGCATTCGTTGGTTTTACCGCTGGAACGGCTCTCAATTATTTCGG
CGCGCAAGCCACATTGGCGTTCGGTGGCCTCGGTTATGCCATGTATTCCG
CATCCTTTCTCTCTTATAACCACACCAAGAACGAAGGATTTGTCCTCTTC
GCTGGCGCTTTCCTGGGTGTATGTGCCGGGCTCTTATGGTGTGCCCAAGG
GACTGTAATGATGTCCTATCCCATGGAGAGTGAGAAAGGTCGATACATCG
GGCTGTTTTGGGCTATCTTCAATATGGGCGCTGTTATTGGGTCATGCATT
CCCATCGCTACTAACTGGAGCAGTCCAGACAACGGCGCCGTCAACGATGG
CACATACGTAGGCTTTTTGGTTCTCATGCTCTGCGGTGCAGTCCTTGCGT
TTTTTCTTGTTCCCCCGG

Sequences in the Contig:

SY0AAA56YL06FM1 SY0AAD63YF13FM1