Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1611
Length(NT) : 894
Best Gene Model Blast : Link to GSTUMT00006981001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001215320.1| Score: 137 E_value: 1e-06
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1611
TTGGCCAACTTTTTTGTACAAAGTTGTCCTTTTCTTTTTAACGTTACTTT
ACGTTCCTTCTGCTTTTCTTTCTTCCTTCCTTTCGACTGGAAAGTTTTAC
GTTCCTTACAACTGGCTTGTCTTCATTCTTTTTTTCACTTTTTTTCACTG
CTGAATTAGTCGACCCCCAACATTCCTCGCGCATATTCCGTACGGGTACG
GTTCGATATTTTGCGATGCGAAAATCACTCATCTCCGCCTTTCTCTTCCT
CACTCTCGCTCGGGCCAGGGTTAGCTTCAATACAACGGTTAAGGGTTTCG
ACTACGACGGTATTGTTCCAGCCACTGGTCTGAGTGAATCCTGCGCAGAG
GCGTATGCTGCACGAGTCTCCTGCACAGATCACCTCTTCAAGCTGAGAGA
CTTGGAGAAGGGCAGCAAGCTATTCCGCACTAAAGAACTCGCCCAATTTT
GCACTCAGGATTGTGTGGATAGTTTGAATGAGTGGGACACAAATCTCCAA
GGCAGCTGTGATGATAGGGACAAGAATTTTGCGAATAGTCTTGGGTCGGG
AGTTTACTTGGGGATGGCGTTGAAGGATAAGCATTCTGTCCAGGAGAACC
TCTATTGGTCCTTTTGTTTGAAGGACGAGAAATCGGGAGAAAAGAACGAC
TTCTGCCTTGCCAAAAGCGATGACCTACCCGCCTGGCCCTCAAACACTGC
CGGGAACGCTTCCGATACGGCTCTTATCTCGGATTTCTGCAAGAGCAGCT
GTAGGACTCAGCAATCATACCTCATGCATAGATCCGCCAAGCACCTCGGA
TTCTCCGCTATTGATCTTGCAGACGCTGAGAAAATTTGCCCTGGGCTAGA
CGTCTCTACCTTCCCCGTTAGCATCGAGATGCTCGATGCCTTCG

Sequences in the Contig:

SY0AAA13YH21FM1 SY0AAA24YM21FM1 SY0AAA24YM21FM2
SY0AAA45YC16FM1 SY0AAA46YL02FM1 SY0AAA56YK11FM1
SY0AAD23YD16FM1