Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1610
Length(NT) : 1558
Best Gene Model Blast : Link to GSTUMT00004369001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein CIMG_09143
Accession: ref|XP_001239522.1| Score: 441 E_value: 2e-41
KEGG Definition: hypothetical protein
Accession: ani:AN0162.2 Score: 432 E_value: 9e-41
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O60158|YHYA_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1610
TTGGAGCTCGTTGACATGCGCCGCCTTGGGCAGACCAATTTGGGAAGCAA
AGGTGGAAATGAAGCGGTTCTTTTTTCCTATGTACATCTTCGAGCGCCTC
TCCCACAGTCTTTGGAAGGCTCGGAAATCTTTGGATCGATGGCACCTGAA
TCGTACTTCTTGATGCGCAGAAGCCAAGATGGATACGTGAGCTCTACGGG
AATGTTTAAGGCCTCTTTCCCCTGGGCTAAAAAGAAGGAAGAGGATCACG
AAAGGCAGTATGTGAGGGAACATTTCGAGAAGACATCCCCAGATGAAACT
GCAGGAAATTTGTGGATCCACCCCACTGATGCCCTGGCTTTGGCCGACGA
CTATGGAATGAGACTGTGGATTGAAGCCCTACTGGATAACGAGTCTGTGA
TCCCCTCTGACCATCGCAAACGAAACATTACTCCTCCACCCCCTTATTTC
AAGCCAGCCGAATCTGACGCGGGATCCGTTGCGTCCAGCACTGCACCCGC
TCCTCGAAGACGGTCTACACGATCAGTCTCACCTAGTAAACGTCTTGGAT
CAACTCCACGAAAAACACGCGCGAAGGCAGCCAAGGATAGCCCTTTAAAA
AAAGAAGTTGCACCCATCGTAGAGGCTATGGAAGAAGAGACCGAGGTCGT
TACCCTCACAACAACCGAGAAGACGACACTGACTTCTACCGAGACTGCTC
CTGTATTGACCAACGGCAATGGAATCGAAACCAGTCTAACCACTCCAGCC
AAGGGTGAGCCAACGATAAAACTTCGAGTTGACCAGGAAAGCGAGGAGAA
AGGAGATGTTACGGTTGCAAGAAATAGCGTTAAGCTCGAACTTGCATCTG
GCGAGCTCGAACTCCCAGCTGGCAAGATCACGGTTCCAATTGTAGAGACT
GCACAGGAAATGATTGCTAAAGCTAAGGAAATGGTAGCTGAGGCCCAACG
CCTCGACAGTGGCTCCGATGTCATTCCCGTCAACGGTGTCGGCAGAAAGC
GAAAGGCCGAGGATGTAGAGTGCGCTGAAGAGGTTGGTGCTGGTGAAGAG
TCTGGCTATAGACATGTCAAGAGGTCAAAGGTTCTGGAGGAAGAATTGAA
AAGAGAGAAAGTCAAGAATAAGGCTTTAATTGGACTGACAGCAGTCTTGG
CTATCGGAGCCATATTCCCCTATGTTCTATAGTGTGGGAAGGTTTTGCCA
GACATGACTCGATTTTCACGAACATTATCCTGGATTATCTGAGGAATGTG
ATTCCTTATCTACCAGAGTTCTTAGGTTTTCACGAGTCGACCCTGTCATG
ATATGCTTATAGTTCTCCCGTTTTTTTATTTTTCTGTCCTCAGTATAACA
TTTCTTTTCGACTTGTTTTTTATTATTCTCATTTTCTAAGCTACTGGAAT
TTAAAAATACTATCGTTAGCCCCAGATATGTTCTCTACTTTCCCACTTAC
TTTCTTTTCTTCCGTTTTCTAATTATCAATTGTCTTTTTCAAAGGGACTT
TTCGTCTTCAGGGGTATTTGTTAAGAGTCTATTGGTTACAGACTCAGCAC
TTGACCTG

Sequences in the Contig:

SY0AAA48YB04FM1 SY0AAA56YG10FM1 SY0AAA56YJ16FM1
SY0AAB8YK12FM1 SY0AAC19YD03FM1 SY0AAC52YO09FM1
SY0AAC57YD02FM1 SY0AAD62YN01FM1