Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig161
Length(NT) : 895
Best Gene Model Blast : Link to GSTUMT00010457001 E-value : 0.0
Numbers of ESTs : 300

Blast Results:

Nr Definition: hypothetical protein CHGG_06730
Accession: ref|XP_001222825.1| Score: 236 E_value: 4e-18
KEGG Definition: adhesin, putative
Accession: afm:AFUA_2G10130 Score: 191 E_value: 3e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig161
TTGGCCAACTTTTTTGTACAAAGTCGTGTTGGCAAACATCCCACCTCATC
AACTCGACCCAAGCCGCCTTCCGCATTCACTTTCGAGAACCAATTCAACC
AACTTTATAACCACTCGCTCGCTATAAAAACAAAATGAAGTCCATACTCG
CCGTCGTCTTTACCCTCCTCAGCTTTTTCCTCTTGACCTCCGCCGTCCCC
GCTCACGGCCCGTCATGTGAGCAGTGCGATCCTATCCCGCCCAACAATCG
CTGCGATATCACCACTTCTTGCATTCGCACCGAACCCAATGGGCAATACC
ATTGTGCATGCCGTGCCGGATATCAAGCCGATGCTCCCGTTACTGATTCC
ACCACGCAATGGCGCACTAAGTTTATCGGGCAGGAGTACAGGGTTTTCGT
CAAGCCCGGTGTCGTGTGCAATACTCTCTGCGCCGACTCCGCCCAGGGTG
CCAACTCTTGCCAGGCAATTACTATTAGGCCTGAGTGCTCTTAAGTTTGT
GCTTCAATTGCTTTAGGGGGTGTAGGATCGGGATTCTTGGACTTGGAAAT
GGATTGCGGGAGACCGGGCGTTTTGGCCTCTCCCAACAATAGCTGAGAAC
GGGAGTTTTTGGAACGTGGTGCATTTCCCAAGCTTGGACAATTTAGCGGT
GGTTTGGGTTCGGAACCGTTAGTGGCTGGGATTGGTTTTAACAATGATTT
CCCTTTCTTTTTTGTCAGGCGGAAGGCATATACGGTTGGGGTAATTTTCT
TGTCGCTCTTTTTGTCGCTCTTTTTGCCCACTGTCAAGTTGTGGAGCGCC
GGGGATGAATATAATTCTTGAAAATCTAGTTTATGACAATCTCGAGTGAT
ATATTGTGATTTATAAACTTTTAGTAGAGAGCAACATCGACTGGC

Sequences in the Contig:

SY0AAA10YD10FM1 SY0AAA11YI04FM1 SY0AAA12YJ05FM1
SY0AAA14YI17FM1 SY0AAA15YC20FM1 SY0AAA15YN23FM1
SY0AAA16YB10FM1 SY0AAA18YB23RM1 SY0AAA1YG04FM1
SY0AAA22YA07FM1 SY0AAA23YO12FM1 SY0AAA24YG02FM1
SY0AAA24YG02FM2 SY0AAA24YG02RM1 SY0AAA24YL18FM1
SY0AAA24YL18FM2 SY0AAA24YL18RM1 SY0AAA24YP18FM1
SY0AAA24YP18FM2 SY0AAA25YA19FM1 SY0AAA25YA19RM1
SY0AAA26YC22FM1 SY0AAA26YC22RM1 SY0AAA26YI01FM1
SY0AAA26YL22FM1 SY0AAA26YL22RM1 SY0AAA27YG15FM1
SY0AAA27YH22FM1 SY0AAA27YJ03FM1 SY0AAA28YJ13FM1
SY0AAA29YE01FM1 SY0AAA2YJ22FM1 SY0AAA32YA01FM1
SY0AAA32YJ23RM1 SY0AAA33YD08FM1 SY0AAA33YM18FM1
SY0AAA34YB10FM1 SY0AAA34YI14FM1 SY0AAA34YK20FM1
SY0AAA34YO10FM1 SY0AAA35YH19FM1 SY0AAA36YC17FM1
SY0AAA36YH24FM1 SY0AAA37YI11FM1 SY0AAA37YN04FM1
SY0AAA38YF01FM1 SY0AAA39YO22FM1 SY0AAA3YK24FM1
SY0AAA40YM17FM1 SY0AAA41YC22FM1 SY0AAA41YK06FM1
SY0AAA41YL01FM1 SY0AAA41YM12FM1 SY0AAA42YK03FM1
SY0AAA43YC03FM1 SY0AAA44YO02FM1 SY0AAA45YE17FM1
SY0AAA48YD23FM1 SY0AAA48YI02FM1 SY0AAA48YI13FM1
SY0AAA48YI19FM1 SY0AAA48YJ12FM1 SY0AAA52YJ17FM1
SY0AAA52YM22FM1 SY0AAA55YP07FM1 SY0AAA57YA07FM1
SY0AAA58YB05FM1 SY0AAA58YF23FM1 SY0AAA58YJ08FM1
SY0AAA5YK04FM1 SY0AAA61YD03FM1 SY0AAA61YE07FM1
SY0AAA61YL11FM1 SY0AAA62YJ15FM1 SY0AAA6YM08FM1
SY0AAA8YH22FM1 SY0AAA8YJ05FM1 SY0AAB11YF14FM1
SY0AAB11YN07FM1 SY0AAB12YA08FM1 SY0AAB12YM08FM1
SY0AAB13YB06FM1 SY0AAB13YG23FM1 SY0AAB15YG09FM1
SY0AAB16YA22FM1 SY0AAB16YC10FM1 SY0AAB16YD01FM1
SY0AAB16YE20FM1 SY0AAB16YP03FM1 SY0AAB17YB24FM1
SY0AAB17YL08FM1 SY0AAB17YN10FM1 SY0AAB18YI06FM1
SY0AAB18YO11FM1 SY0AAB19YG18FM1 SY0AAB1YA06FM1
SY0AAB1YM21FM1 SY0AAB20YH08FM1 SY0AAB20YM09FM1
SY0AAB21YH01FM1 SY0AAB21YI14FM1 SY0AAB22YC21FM1
SY0AAB23YH05FM1 SY0AAB25YF18FM1 SY0AAB25YL13FM1
SY0AAB27YK17FM1 SY0AAB27YM08FM1 SY0AAB28YK07FM1
SY0AAB28YO14FM1 SY0AAB29YG11FM1 SY0AAB2YB09FM1
SY0AAB2YF16FM1 SY0AAB2YN03FM1 SY0AAB30YE14FM1
SY0AAB30YJ24FM1 SY0AAB31YB21FM1 SY0AAB31YM18FM1
SY0AAB32YI06FM1 SY0AAB32YK08FM1 SY0AAB33YG17FM1
SY0AAB33YM21FM1 SY0AAB33YP20FM1 SY0AAB34YA21FM1
SY0AAB34YB16FM1 SY0AAB34YD19FM1 SY0AAB34YH20FM1
SY0AAB34YK13FM1 SY0AAB34YM08FM1 SY0AAB35YA24FM1
SY0AAB35YN17FM1 SY0AAB35YP04FM1 SY0AAB36YG07FM1
SY0AAB38YE21FM1 SY0AAB38YH01FM1 SY0AAB38YL01FM1
SY0AAB38YM14FM1 SY0AAB39YA20FM1 SY0AAB39YL24FM1
SY0AAB3YD20FM1 SY0AAB3YE07FM1 SY0AAB3YH16FM1
SY0AAB3YK13FM1 SY0AAB3YK20FM1 SY0AAB40YA06FM1
SY0AAB40YD23FM1 SY0AAB40YG17FM1 SY0AAB40YH17FM1
SY0AAB40YH22FM1 SY0AAB41YB18FM1 SY0AAB41YD07FM1
SY0AAB41YF16FM1 SY0AAB41YH01FM1 SY0AAB41YN03FM1
SY0AAB41YN18FM1 SY0AAB42YD14FM1 SY0AAB42YH15FM1
SY0AAB42YN19FM1 SY0AAB43YD07FM1 SY0AAB43YD18FM1
SY0AAB44YA19FM1 SY0AAB44YP12FM1 SY0AAB45YB17FM1
SY0AAB46YH01FM1 SY0AAB46YJ09FM1 SY0AAB46YK10FM1
SY0AAB46YM06FM1 SY0AAB47YK20FM1 SY0AAB47YL09FM1
SY0AAB47YN12FM1 SY0AAB48YJ02FM1 SY0AAB48YL12FM1
SY0AAB48YM22FM1 SY0AAB48YP04FM1 SY0AAB49YH06FM1
SY0AAB49YH23FM1 SY0AAB4YG24FM1 SY0AAB4YP22FM1
SY0AAB50YD21FM1 SY0AAB50YG06FM1 SY0AAB50YH16FM1
SY0AAB51YE11FM1 SY0AAB51YE21FM1 SY0AAB52YB01FM1
SY0AAB52YI03FM1 SY0AAB52YI21FM1 SY0AAB54YI24FM1
SY0AAB56YC13FM1 SY0AAB56YO07FM1 SY0AAB58YB01FM1
SY0AAB58YN09FM1 SY0AAB59YF16FM1 SY0AAB59YF23FM1
SY0AAB59YI13FM1 SY0AAB59YP22FM1 SY0AAB5YJ09FM1
SY0AAB60YF17FM1 SY0AAB60YO06FM1 SY0AAB61YL04FM1
SY0AAB61YL19FM1 SY0AAB6YJ13FM1 SY0AAB6YN12FM1
SY0AAB7YC08FM1 SY0AAB8YE19FM1 SY0AAB8YG24FM1
SY0AAB8YL22FM1 SY0AAB9YA20FM1 SY0AAB9YJ15FM1
SY0AAC16YL13FM1 SY0AAC19YI20RM1 SY0AAC1YC04FM1
SY0AAC21YO18FM1 SY0AAC28YD08FM1 SY0AAC28YD08RM1
SY0AAC28YD22FM1 SY0AAC29YP21FM1 SY0AAC2YE09FM1
SY0AAC31YD24FM1 SY0AAC33YH22FM1 SY0AAC33YM19FM1
SY0AAC34YF14FM1 SY0AAC35YG06FM1 SY0AAC36YK01FM1
SY0AAC37YA20FM1 SY0AAC37YG11FM1 SY0AAC39YC19FM1
SY0AAC39YP14FM1 SY0AAC45YA12FM1 SY0AAC45YH16FM1
SY0AAC46YP13FM1 SY0AAC49YL05FM1 SY0AAC4YL13FM1
SY0AAC53YA19FM1 SY0AAC54YJ08FM1 SY0AAC55YG14FM3
SY0AAC56YG06FM1 SY0AAC56YH09FM1 SY0AAC58YI07FM1
SY0AAC59YB01FM1 SY0AAC59YN23FM1 SY0AAC5YL07FM1
SY0AAD15YN06FM1 SY0AAD17YC11FM1 SY0AAD17YP03FM1
SY0AAD17YP06FM1 SY0AAD18YF09FM1 SY0AAD18YG23FM1
SY0AAD18YH01FM1 SY0AAD18YM13FM1 SY0AAD1YL12FM1
SY0AAD23YA10FM1 SY0AAD24YH12FM1 SY0AAD25YE19FM1
SY0AAD25YM17FM1 SY0AAD29YE09FM1 SY0AAD31YP10FM1
SY0AAD33YO01FM1 SY0AAD33YO08FM1 SY0AAD34YK14FM1
SY0AAD35YJ17FM1 SY0AAD36YL16FM1 SY0AAD36YP05FM1
SY0AAD38YN11FM1 SY0AAD39YA15FM1 SY0AAD39YB12FM1
SY0AAD39YJ24FM1 SY0AAD39YM16FM1 SY0AAD41YK22FM1
SY0AAD42YK02FM1 SY0AAD42YN21FM1 SY0AAD43YL16FM1
SY0AAD44YI11FM1 SY0AAD46YL22FM1 SY0AAD48YH17FM1
SY0AAD49YM14FM1 SY0AAD50YK23FM1 SY0AAD52YD13FM1
SY0AAD52YJ07FM1 SY0AAD53YC03FM1 SY0AAD53YH20FM1
SY0AAD53YO22FM1 SY0AAD56YD08FM1 SY0AAD56YD24FM1
SY0AAD56YG05FM1 SY0AAD58YO22FM1 SY0AAD59YF08FM1
SY0AAD59YF16FM1 SY0AAD59YL19FM1 SY0AAD59YL23FM1
SY0AAD5YG11FM1 SY0AAD5YJ11FM1 SY0AAD61YL16FM1
SY0AAD62YA01FM1 SY0AAD62YK09FM1 SY0AAD63YE01FM1
SY0AAD63YO04FM1 SY0AAD6YA15FM1 SY0AAD7YC19FM1
SY0AAD7YJ13FM1 SY0AAD8YM16FM1 SY0AAD9YG15FM1