Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1609
Length(NT) : 904
Best Gene Model Blast : Link to GSTUMT00002461001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1609
TTGGGGGCAGTCGCCTCAAGATCAGCCATACCCAAACCCCGGTGTGGTAG
TCTCCTTTACAAACTATCACAGCGCCCCATCCCTACTCCGGCCAAAATGC
AGAGCACATCGAGGAAAAAAGTACCATCACACCCTCACTTTCCATCGGTG
TGCGCCATTGGGCTAATTTTCTAAAGAGCCGTTACGACCCAAGGGATGAC
GACCCCTCAGAAGATAAGGCCCTCCGAACCCTAAGGTTGATGAGAGAAAC
TCATAAACAACAACGTGACCGACTTCTTGCTAGACACCTGCGAGAGAGTG
AACAGTGGAAGAAAGACGCGGTAGCCTCTATTGATTGGGATAACACAGAA
CTTGTTGCAAATGTACCTGGGAGCCCCCCCACCATGTTGGCATATTCAGT
CGATCAGATATCCACCCCTGAGGCCGAACAGGCTCTTGAGATCATGCCGG
CTGAATACCGCCATACCATAGTGTCCATCAAGCAATTTGACCGCCCGCCC
AACAGCAATTCCAATAGAGCGATGCTGGACTCTTACAAGCTTGCTGGCAT
GTTTGCCGACGAAGGTGTACATATGAGGCAGCGAATGGTACGGGAGGAAC
AGGACTTGAGGACTCTTCAGGAACATGAGAAGGCGCCATACTACGAAGTC
CTGAGGCGACAAGATCCTGAACGTTACAACGCAAAGGAAGGAGTGCCTCT
TCCTACAAAAGCTGGAGCAAACCAATCCCACCACTTGAGCTTGAGGGCAT
CGGGAGCCCGCCGGGATTCTGGACCTTCCCATACGTTAAGCAGTAGTAAT
GCGCCCGGAGTCGGCACGGCCACTGACTATTTTGGGCAGAAAGGTGGCCC
TGAAGCTGTTGGATCCTCGGGAGCCTCTGCGGCCAAGAGTCGCGACCCAC
GCCC

Sequences in the Contig:

SY0AAA56YJ09FM1 SY0AAB43YO06FM1 SY0AAB44YF02FM1
SY0AAC14YB09FM1 SY0AAC20YI05FM1