Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1608
Length(NT) : 958
Best Gene Model Blast : Link to GSTUMT00002589001 E-value : 1e-171
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CHGG_09750
Accession: ref|XP_001227677.1| Score: 342 E_value: 2e-30
KEGG Definition: xanthine/uracil permeases; K03458 nucleobase:cation symporter-2, NCS2 family
Accession: aor:AO090005000455 Score: 322 E_value: 2e-28
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG1292 Score: 119 E_value: 4e-07
PFAM Definition: Xan_ur_permease, Permease family. This family includes permeases for diverse substrates such as xanthine, uracil and vitamin C. However many members of this family are functionally uncharacterised and may transport other substrates. Members of this family have ten predicted transmembrane helices..
Pfam Number: pfam00860 Score: 126 E_value: 7e-08
Swissprot: P48777|UAPC_EMENI

Sequence:
>Contig1608
TTGGATTATGATGGCTTCCTTTTATTGCTCATTCTTATCGCTGTTCTGGT
TACGTGCGAATCTTTTCAGGCTTACCTGCATGGTACCGACCTGCCCCAGA
CCTGCAAGTATGCCTACCTTTCTATGATACCAAGTCTTCTACTATATAAA
GCTTGATCTTCAGGGAGAGCTTTTCATCGTCTTGGAAGGAATTGCGATAT
ATTAATAACGAACCCACCTTTCGACTCTTGTCCTTTCCCTTCAATCGTCG
ATCGATACTCACTCGGGTTAACAAGTATCACCGAATTGCTTGGAGTTGCT
TCGATACACACCAACCGACCCGTACTCCTATCGTCGGTTCTCCTTAAATT
TGCGCTTAGCCTCTATCCTACGGGCACAGTATCAAAATGACAGAGCCGGA
TCAAATTGTTCCCTCGACGGTGCGCAAGAGGACGTTTGGAGATCATGCTC
GCAGTGTTAAGAAGGCATTGTTGACAAAAGAGGGGCTTCTCGGCGACTAC
GATTATGCCTTTTTGTTTCGGGTATGGGAATTATGAGCCTCCATGCCCGT
CTCCACACCTCTTCCCGTCCACCCTTTCTACCCCCGCATATTTCTACATA
GCAGAACAAGCAGGAGCAAAGCGCAATACTTACCAACCGGGAATCCAACA
ATGTAGCCTAGGCTCCCATTCATGAGGAAGCCACGCCGATCGGCGCCTTT
TTTCGGACTAGATGATCGGATGCCGGTATTGCTTGCGCTACTATTAGGGT
TTCAGCATGCTCTAGCAATGCTGGCGGGAGTAGTTTCCCCACCATTAATC
CTAGGAGGGGCAGGAGGTGCCAACTTGTCGGCGGGGGCTCAACAGTACCT
CGTTTCCACCGCATTGATTGTTTGCGGTATATTGTCTGCTATTCAGATTA
CCAGATTCCACATCTGGGGAACCCCTTATTACATCGGGACTGGCCTTATA
TCTGTTGT

Sequences in the Contig:

SY0AAA33YK20FM1 SY0AAA56YI15FM1