Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1607
Length(NT) : 574
Best Gene Model Blast : Link to GSTUMT00008348001 E-value : 1e-132
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543146.1| Score: 297 E_value: 1e-25
KEGG Definition: hypothetical protein
Accession: afm:AFUA_1G05745 Score: 261 E_value: 1e-21
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG4826 Score: 108 E_value: 4e-06
PFAM Definition: No Hit Found

Sequence:
>Contig1607
TTGGCCCCAACCTTCGCAAAACCTCCAGCATGTCTACAACCCACGGCACC
CCTAAAGCAATCCCAATCTGGATCATCTTCTCAACCCTGGTAGTAATTTA
CGACGCATTGTACATCCTCTTCCGCCCATACTCCTTCCCCCCCAGCGCCC
TCTCTAAGATCTAGCCGGGCCACACCTTCTACGCCACGGTAGACCACCTC
TACAGCGCCAGCACCTTCGCCGAGCAAGATGGCTTCCCGGCCGCACAGAG
TTGGATGAACCTTGTCGAGTCGGCTGTCAATCTCGTCTACCTTGCCAAGT
ACTATTGCGGCGGCGGCGGCGGCGGCGCCGGGGGTGAAATGCTGGTGGCG
GGGTTCGCTGGTGTGCTCATGACACTAGCGAAGACGACGTTGTTTGTGCT
TAACGAGTTTTGTGCCGGGGGGAGGCATGTTGCGCATAACGATTTGAAGA
ATTTTGTCCTGTTTTATGTCTTGCCTAATGGTCTTTGGATCGCGTTTCCG
GGTTGGTGCACGTATTGGTTTGCCAGGGAGATTGTCAAGGGAATTGACAC
TGGGAGTGGGGGTAAGGTTAAGAA

Sequences in the Contig:

SY0AAA3YI03FM1 SY0AAA56YH22FM1