Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1606
Length(NT) : 708
Best Gene Model Blast : Link to GSTUMT00002835001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57037.1| Score: 272 E_value: 2e-22
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 272 E_value: 9e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1606
TTGGATACCTCCCCCATCGCCTAGATTTCGAACAGGATAGACTGTAAGGC
GAACAAGTCATTCAATGTCAATCGTTTCAACAATATATCGCCCACACAGC
CATAGCGGATGACAAATCTGAGGTCCTACGGTGGTTGTCACCCCTCAAGC
CCGAGAAAAGACATCAACATTTAAGGGAGAACCGACTCGAGAGCGTGGGG
CAATGGATTTTTAAAACAAGTGAGTTTCGGAAATGGGATACGGGAGCAGA
TGGATCTCCTGATTCAGTAATATTTTGCCATGGCGATCCAGGTGTGGGGA
AGACTCATCTTGGCTCTGTCGTAATTGATTATTTTTATGGTAGCGGAGAG
GTTGTCACGGTCGCCGGGCTGTATTGCGACTACCTCGACAGAAGGGGACA
GACTACATCAAACATGCTGGGAGCCATGCTTAAGCAGTTGGCCGGCAGCG
GACCCATTCCCGAGGAGATACGTAAAGCTTTCGAAATCGCAAAGAACCAT
TTTGGCGGGGTAGGCCCTCGAGTTCCTGAGCTCGTCGATATGCTGAAGGC
GGCAATTGCCCAAAGACAACGGGTGGTTATATGTATTGATGGCTTGGACG
AATTGCTCGCCGCAGATCGGACTGGCCTTCTAAGCTCTCTGCAATCTATC
GGTCAGGAGTTGCCAAATGTCCAGCTATTTGTGATCGGAAGGCCTTTCAT
CCGGACTG

Sequences in the Contig:

SY0AAA55YK23FM1 SY0AAA56YH14FM1 SY0AAB58YG07FM1